BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_K352002 1 BBa_K352002 pCooF Promoter from Rhodospirillum rubrum 2010-10-01T11:00:00Z 2015-05-08T01:12:11Z S.W. Singer, M.B. Hirst and P.W. Ludden, CO-dependent H2 evolution by Rhodospirillum rubrum: role of CODH:CooF complex, Biochim Biophys Acta - Bioenerg 1757 (2006), pp. 1582???1591 CooA is a CO-sensing protein that activates the transcription of genes encoding the CO-oxidation (coo) regulon, whose polypeptide products are required for utilizing CO as an energy source in Rhodospirillum rubrum. CooA binds to a position overlapping the -35 element of the P(cooF) promoter, similar to the arrangement of class II CRP (cAMP receptor protein)- and FNR (fumarate and nitrate reductase activator protein)-dependent promoters when expressed in Escherichia coli. The CO-dependent anaerobic growth of Rhodospirillum rubrum relies on a CO oxidation system encoded by two CO regulated transcriptional units, cooMKLXUH and cooFSCTJ. The key products of the coo regulon are an O2- sensitive CO dehydrogenase (CooS), a CooS-associated Fe-S protein (CooF), and a CO-tolerant hydrogenase (CooH), and the expression of the genes depends upon the activity of the CooA protein, which senses CO under anaerobic conditions. CO-independent basal level transcription of PcooF is not detectable due to the absence of active CooA. false false _474_ 0 5815 9 It's complicated false The sequence information was acquired from NCBI and physical DNA was synthesized from GENEART. Classical cloning strategies(restriction digestion) were used to produce biobricks. false Ozkan IS annotation2081253 1 CooA binding site range2081253 1 41 44 annotation2081258 1 Protected by CooA+RNAP range2081258 1 23 91 annotation2081257 1 Protected by CooA range2081257 1 36 61 annotation2081254 1 CooA binding site range2081254 1 52 56 annotation2081255 1 -10 Region range2081255 1 79 84 annotation2081252 1 A+T rich sequence range2081252 1 8 33 annotation2081256 1 Transcription Start range2081256 1 92 93 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K2115005 1 BBa_K2115005 Low levels of carbon monoxide detection 2016-10-13T11:00:00Z 2016-10-14T03:00:29Z pCooF: it comes from the transcription factor CooA from Rhodospirillum Rubrum. RBS: ribosome binding site. Purple chromoprotein LuxI: part of the quorum sensing system Terminator: an RNA sequence that usually occurs at the end of a gene or operon mRNA and causes transcription to stop. pCooF promoter is regulated by the transcription factor CooA when there are low levels of carbon monoxide in the environment, when this promoter is activated a purple chromoprotein and a LuxI promoter will be transcribed. The expression of LuxI is going to bind to the SAM molecule that is going to integrate AHL molecule, which is going to bind the expression of LuxR. All of the above mentioned allows the transcription of plux promoter (BBa_K2115002) false false _2583_ 33161 33161 9 false Coordinating the action of Lux promoters. false Antonella Elizabeth Osses Toledo component2509410 1 BBa_B0012 component2509399 1 BBa_B0030 component2509397 1 BBa_K352002 component2509402 1 BBa_K592009 component2509404 1 BBa_B0030 component2509407 1 BBa_C0061 component2509414 1 BBa_B0010 annotation2509410 1 BBa_B0012 range2509410 1 1473 1513 annotation2509407 1 BBa_C0061 range2509407 1 822 1439 annotation2509397 1 BBa_K352002 range2509397 1 1 94 annotation2509404 1 BBa_B0030 range2509404 1 801 815 annotation2509399 1 BBa_B0030 range2509399 1 103 117 annotation2509402 1 BBa_K592009 range2509402 1 124 792 annotation2509414 1 BBa_B0010 range2509414 1 1522 1601 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1761 1 luxI range1761 1 1 579 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation1760 1 LVA range1760 1 580 611 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K352002_sequence 1 ttcggcgtcttttcatacccccataaaaactctggataactgtcatctggccgacagacggggccgggctttttgtcgcttactcggcgccagg BBa_K2115005_sequence 1 ttcggcgtcttttcatacccccataaaaactctggataactgtcatctggccgacagacggggccgggctttttgtcgcttactcggcgccaggtactagagattaaagaggagaaatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataatactagagattaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z