BBa_K2116003 1 BBa_K2116003 Pconst_esa(5) 2016-10-12T11:00:00Z 2016-10-19T05:51:53Z esabox sequences come from [] Anderson promoter j23118 with one esabox as a roadblock regulator. false false _2584_ 31332 31336 9 false an esabox is just 18 bp false Asli Azizoglu annotation2520160 1 J23118 promoter range2520160 1 1 35 annotation2520161 1 esaR binding site range2520161 1 36 65 BBa_K2116003_sequence 1 ttgacggctagctcagtcctaggtattgtgctagcggtacccctgtactatagtgcaggggtacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z