BBa_K2116005 1 BBa_K2116005 AND gate regulated by norR and esaR (two esaboxes) 2016-10-12T11:00:00Z 2016-10-24T11:54:28Z PnorV comes from E.coli genome, esaboxes from [] AND gate constructed by placing 2 esaboxes after the transcription start site of PnorV. false false _2584_ 31332 31336 9 false ... false Asli Azizoglu annotation2520177 1 esabox range2520177 1 328 345 annotation2520176 1 spacer range2520176 1 320 327 annotation2520169 1 NorR binding 3 low affinity range2520169 1 149 158 annotation2520171 1 NorR binding 1 high affinity range2520171 1 189 209 annotation2520170 1 NorR bindin 2 low affinity range2520170 1 162 178 annotation2520172 1 sigma54 binding site range2520172 1 250 282 annotation2520168 1 norV promoter range2520168 1 1 285 annotation2520175 1 esabox range2520175 1 302 319 BBa_K2116005_sequence 1 acgtagcaacgcagacgcatcgcactccagcacctgacgtagcgtggtgatcaggcgctgaaaacgatcctggtgaccaatcccacgctgcaattcgatggcgatattcgccagcacatcaacggaaaaactcatctttgcctcactgtcaatttgactatagatattgtcatatcgaccatttgattgatagtcattttgactactcattaatgggcataattttatttatagagtaaaaacaatcagataaaaaactggcacgcaatctgcaattagcaagacatctttttagggtacccctgtactatagtgcaggtagagtctcctgtactatagtgcaggggtacctctaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z