BBa_K2116025 1 BBa_K2116025 EsaR repressible promoter 2016-10-13T11:00:00Z 2016-10-16T04:39:52Z The Anderson promoter sequences were taken form the registry. Esabox sequence comes from the Pantoea stewartii ssp. stewartii. An esabox is an 18bp sequence to which the transcriptional regulator EsaR can bind. We placed one esabox right after the normally constitutive Anderson promoter [Bba_J23118] to create an EsaR repressible promoter. Transcription can be initiated by the specific AHL EsaR responds to [N-(3-oxo-hexanoyl)-L-homoserine lactone]. false false _2584_ 31336 31336 9 false The esabox has to be placed after the transcription start site to be able to act as a roadblock. false Asli Azizoglu annotation2512420 1 Anderson Promoter, BBa_J23118 range2512420 1 1 35 annotation2512421 1 esabox range2512421 1 41 58 BBa_K2116025_sequence 1 ttgacggctagctcagtcctaggtattgtgctagcggtacccctgtactatagtgcaggggtacctctaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z