BBa_K212000 1 BBa_K212000 Histamine Binding Protein 2009-10-18T11:00:00Z 2015-05-08T01:11:29Z This part was sent to us by Dr. Guido Paesan as a miniprep in a bacterial vector. However, it originally comes from genomic DNA of tick salivary glands in Rhipicephalus appendiculatus. EV131 (also known as rRa-HBP2) is a histamine binding protein, and one of three discovered in the salivary gland extracts of Rhipicephalus appendiculatus ticks. Two major proteins (Ra-HBP1 and Ra-HBP2) were found in the saliva of female ticks, and a third protein (Ra-HBP3) was retained from male salivary gland extracts. On SDS gels, the proteins have apparent molecular masses between 20 and 25 kDa. The crystallographic structure and biological activity of these HBPs (Histamine binding proteins) indicate that they sequester histamine at wound site, outcompeting histamine receptors for the ligand, thereby overcoming their hosts??? inflammatory (and related immune) responses and feeding successfully. Acting independently of the membrane-bound H1, H2, and H3 receptors, HBPs offer a new approach to the control of histamine-based diseases, such as allergic rhinitis. Binding of histamine to the three rHBPs appears to be saturable. Scatchard plots show high affinities for rRa-HBP3 (equilibrium dissociation constant [KD] 1.2X10^-9 M; SD=0.4; three measurements) and for rRa-HBP2 (KD 1.7x10^-9 M; SD=0.9), but a lower affinity for rRa-HBP1 (KD 1.8x10^-8 M; SD=1.2). A series of histamine-like compounds were tested for their ability to compete with 3H-histamine for binding to the proteins. Depending on the protein tested, 100???240 times more 1-methylhistamine than cold histamine, and 600???1000 times more 3-methylhistamine, were needed for a 50% reduction of bound radioactivity. No significant competition was observed with other related compounds (histidine, imidazole, serotonin, dopamine, the H1 receptor agonist betahistine, the H1 antagonists chlorpheniramine and pyrilamine, the H2 agonist dimaprit, the H2 antagonists ranitidine and cimetidine, and the polyamines putrescine, spermine, and spermidine). This indicates highly specific histamine binding, different from that of the mammalian H1 and H2 receptors (Gantz et al., 1992). false false _314_ 0 4681 9 It's complicated true Not Applicable. false Elias Scheer BBa_K212000_sequence 1 atgaagcttctcatactctctcttgccctcgtcctcgccctcagccaggttaagggaaatcagccagattgggccgatgaagcggcaaatggtgcacaccaagacgcctggaagagtctgaaagcggacgttgaaaacgtttactacatggtgaaggccacctataagaatgacccagtgtggggcaatgacttcacttgcgtgggtgttatggcaaatgatgtcaacgaggatgagaagagcattcaagcagagtttttgtttatgaataatgctgacacaaacatgcaattcgccactgaaaaggtgactgctgttaaaatgtatggttacaatagggaaaacgccttcagatacgagacggaggatggccaagttttcacagacgtcattgcatactctgatgacaactgcgatgtcatctacgttcctggcacagacggaaatgaggaaggttacgaactatggactacggattacgacaacattccagccaattgtttaaataagtttaatgagtacgctgtaggtagggagacaagggatgtattcacaagtgcttgcctagagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z