BBa_K212003 1 BBa_K212003 pAgr (S. epidermidis agr operon promoter) 2009-10-19T11:00:00Z 2015-05-08T01:11:29Z This part was PCR'd from Staphylococcus epidermidis (ATCC 12228) genomic DNA. The agr operon transduces the signal that a quorum of S. epidermidis has been reached, based on the extracellular concentration of signalling oligopeptides (see refs 1 and 2). When the bacteria reaches a quorum, the genes under the agr operon are usually turned on (this includes virulence factors that can create a biofilm). false false _314_ 0 4681 9 It's complicated true On the Staphylococcal agr operon, there two promoters: P2 and P3, which are read in two different directions. Here, we have the entire promoter region. Genes may be ligated on the C terminus of this part to get the agr promoter functionality. false Elias Scheer BBa_K212003_sequence 1 gtacgtaatgttaaaaaaatataatttataacttcactcctttcgaattaaggtaatggatacgaatgaatttaacattcactcgactagattaagcaaatttttcaactatctttcaatcacatctctgtgatatgagtctattaaaacatgatttttccatttaaagattaaaatttcgtaaatagcaatatttagtactcaactgtaaaactaaatatggtaaaatatctaatagtacttaattaaaacacttaggtatatttttttaacagttaggcatgctttctaaaaaatgttgcgcaaaattgtataatgacacttgaggagagtagtaaacaagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z