BBa_K2120202 1 BBa_K2120202 mutated ptet-3 2016-10-13T11:00:00Z 2016-10-20T02:11:18Z template is from the kit tetR repressible promoter. The function is similar with pTet[Part:BBa_R0040]. We mutated the -35 region and selected one with lower strength.It can be used to control the expression of toxin proteins to avoid leaking out. false false _2588_ 31066 25299 9 false mutation in -35 region false Hui Luo BBa_K2120202_sequence 1 tccctatcagtgatagagaagactgtccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z