BBa_K2123102 1 BBa_K2123102 Tac promoter + overlap mer operator 2016-10-12T11:00:00Z 2016-10-15T05:22:44Z PO26-CRL Promoter regulated by MerR false false _2592_ 33237 15542 9 false Synthesis false Maria Clara Tavares Astolfi annotation2512553 1 -10 Hexamer range2512553 1 51 54 annotation2512555 1 Discriminator range2512555 1 55 61 annotation2512554 1 Operator Mer range2512554 1 33 50 annotation2512556 1 +1 Sequence range2512556 1 63 63 annotation2512552 1 -35 Hexamer range2512552 1 27 31 BBa_K2123102_sequence 1 gaattcgcggccgcttctagaggagctgttgacatccgtacatgagtacggatataatgggctactatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z