BBa_K2123106 1 BBa_K2123106 Universal promoter (Ptac + PJK26) + mer operator 2016-10-12T11:00:00Z 2016-10-15T07:27:52Z Synthesis New promoters regulated by MerR library false false _2592_ 33237 15542 9 false Synthesis false Maria Clara Tavares Astolfi annotation2512590 1 dna range2512590 1 25 25 annotation2512593 1 dna range2512593 1 50 53 annotation2512596 1 Operator Mer range2512596 1 56 72 annotation2512591 1 dna range2512591 1 27 30 annotation2512589 1 -35 Hexamer range2512589 1 24 28 annotation2512594 1 dna range2512594 1 55 55 annotation2512592 1 dna range2512592 1 36 36 annotation2512588 1 dna range2512588 1 22 22 annotation2512587 1 RopS sigma factor sequence range2512587 1 40 48 annotation2512595 1 -10 Hexamer range2512595 1 45 50 BBa_K2123106_sequence 1 cgaattcgcggccgcttctagatcttgacaaattcttaaatttgtgctataatgtatcgtccgtacatgagtacggatgtttaacttttactagtagcggccgctgcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z