BBa_K2127007 1 MaTif MT - TERMINATOR 2016-10-13T11:00:00Z 2016-10-21T05:23:57Z MT - TERMINATOR MT - TERMINATOR false false _2596_ 32415 32736 9 false MT - TERMINATOR false Mirat Sojitra BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K2127003 1 BBa_K2127003 psbT 2016-10-13T11:00:00Z 2016-10-25T05:51:22Z synchocystis psbT false false _2596_ 32415 32415 9 false coding false Nafaa Haddou component2526861 1 BBa_K2127005 component2526848 1 BBa_R0010 component2526856 1 BBa_B0032 component2526862 1 BBa_K2127007 annotation2526848 1 BBa_R0010 range2526848 1 1 200 annotation2526862 1 BBa_K2127007 range2526862 1 433 555 annotation2526856 1 BBa_B0032 range2526856 1 201 213 annotation2526861 1 BBa_K2127005 range2526861 1 214 432 BBa_K2127005 1 BBa_K2127005 psbT 2016-10-13T11:00:00Z 2016-10-21T05:03:14Z BBa_K2127005 BBa_K2127005 false false _2596_ 32736 32736 9 false BBa_K2127005 false Mirat Sojitra annotation2526422 1 psbT range2526422 1 1 219 annotation2526424 1 double stop codon range2526424 1 215 219 annotation2526423 1 start range2526423 1 1 3 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 BBa_K2127007_sequence 1 cttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttct BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0032_sequence 1 tcacacaggaaag BBa_K2127003_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatcacacaggaaagatgggcgaatcaaagcgtcgtaaacaatcccttggcgatcgctatggccaggatcaacgggttgtggagtggctgcctttaaccaaaaaacaagccgaagatttctataaatggaccaccaaaggagcttggattggcatcggtgttatggcaggcctgtgggttacagtcagatttattggccccacttttggctggtggaccgtccaataatagtagcttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttct BBa_K2127005_sequence 1 atgggcgaatcaaagcgtcgtaaacaatcccttggcgatcgctatggccaggatcaacgggttgtggagtggctgcctttaaccaaaaaacaagccgaagatttctataaatggaccaccaaaggagcttggattggcatcggtgttatggcaggcctgtgggttacagtcagatttattggccccacttttggctggtggaccgtccaataatagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z