BBa_K2127005 1 BBa_K2127005 psbT 2016-10-13T11:00:00Z 2016-10-21T05:03:14Z BBa_K2127005 BBa_K2127005 false false _2596_ 32736 32736 9 false BBa_K2127005 false Mirat Sojitra annotation2526422 1 psbT range2526422 1 1 219 annotation2526424 1 double stop codon range2526424 1 215 219 annotation2526423 1 start range2526423 1 1 3 BBa_K2127005_sequence 1 atgggcgaatcaaagcgtcgtaaacaatcccttggcgatcgctatggccaggatcaacgggttgtggagtggctgcctttaaccaaaaaacaagccgaagatttctataaatggaccaccaaaggagcttggattggcatcggtgttatggcaggcctgtgggttacagtcagatttattggccccacttttggctggtggaccgtccaataatagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z