BBa_K2128004 1 BBa_K2128004 HDLEA1 2016-08-12T11:00:00Z 2016-10-21T02:46:43Z Ramazzottius varieornatus This part is a member is a class of intrinsically disordered proteins called the Late Embryonic Abundant (LEA) proteins that become ordered when desiccated, thereby stabilizing DNA and protein cell components. This tardigrade unique protein is found in the mitochondria of tardigrade cells. When cloned into humans, they confer protection against osmotic stress as shown in the paper "Novel Mitochondria-Targeted Heat-Soluble Proteins Identified in the Anhydrobiotic Tardigrade Improve Osmotic Tolerance of Human Cells" by Sae Tanaka et al. 2015 Feb 12. It was taken from the genome of Ramazzottius varieornatus and optimized by the IDT Codon Optimization Tool for E. Coli K12. false false _2597_ 32302 32302 9 true This part was optimized by the IDT Codon Optimization Tool for E. Coli K12. false David Sanderson annotation2481454 1 HDLEA1_ORF range2481454 1 1 272 BBa_K2128004_sequence 1 atgtcgcccgcagataagaaatgggaggatgcaaaagaggaaggttccgcagcgttcaaggatgcaaaggacgctgcatccttaaaggcaggtgagctgcgcgatagtgccagtcaaaaggccagccagttacgtgatagcagtatccagaaagcgagcgaactggaggattcggcagtacaaaagggatataatctggataagtctgctaacgaaacgatcagtaacgccaaagaggcagttgatcgcaaggtggaacagggaaaaagtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z