BBa_K2128005 1 BBa_K2128005 AAVLEA1 2016-08-12T11:00:00Z 2016-08-13T12:00:10Z Aphelenchus avenae This part is a member is a class of intrinsically disordered proteins called the Late Embryonic Abundant (LEA) proteins that become ordered when desiccated, thereby stabilizing DNA and protein cell components. It was taken from the genome of Aphelenchus avenae and optimized by the IDT Codon Optimization Tool for E. Coli K12. false false _2597_ 32302 32302 9 false This part has been optimized by the IDT Codon Optimization Tool for E. Coli K12. false David Sanderson annotation2481455 1 AAVLEA1_ORF range2481455 1 1 432 BBa_K2128005_sequence 1 atgtcctcacagcaaaatcagaatcgccagggagagcagcaggagcaaggatacatggaggcggcgaaggagaaagtcgtaaatgcctgggaaagtacaaaagaaactttaagttcaactgctcaggccgcagctgaaaaaactgctgagtttcgtgattcggcgggtgaaactatccgcgacctgacgggccaggcgcaagaaaaggggcaggaatttaaggagcgtgctggtgagaaagccgaagaaactaagcagcgcgctggcgagaagatggacgaaacaaagcaacgcgcgggggaaatgcgtgagaatgccggtcagaagatggaggagtacaaacaacaggggaagggaaaagcagaagagttgcgcgatacggcggcggagaaattgcatcaagccggtgaaaaagtaaaaggacgcgattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z