BBa_K2128008 1 BBa_K2128008 H. dujardini ACTN promoter w/ 5' UTR 2016-09-21T11:00:00Z 2016-10-18T01:29:18Z Hypsibius dujardini Constitutive promoter of the actin gene in the tardigrade Hypsibius dujardini. Actin is a protein involved in the formation of the filaments of muscle cells as well as cell mobility and contraction. false false _2597_ 32302 30412 9 false Sequence was taken by identifying the actin gene in the genome of Hypsibius dujardini. 500 bp upstream of the actin start codon was taken and subsequently ran through a promoter prediction tool which can be found at fruitfly.org. false Sunil Deochand, David Sanderson BBa_K2128008_sequence 1 gttggcgtacaggtccttgcggatatcaatgtcgcacttcatgatcgagttgtaggtggtctcgtggataccgcacgactccatacctgtcggcagacaacggagaaaacgtgaaaagacgggccaaacacaggcgcaaggtccgaatagtcgggctgactggacgctgtctgtctgtctgcctcaattcttaccgatgaagctgggttggaagagggcctcggggcatcggaatcgctcgtttccgatggtgatgacttgaccgtcgggaagttcgtagctcttctccagggaggacgaggcagcagcggtggccatttcctgctcaaagtcgagggcgacgtagcagagcttctccttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z