BBa_K2128009 1 BBa_K2128009 H. Dujardini ACTN Termanator w/ 3' UTR 2016-10-17T11:00:00Z 2016-10-18T01:39:13Z H. Dujardini Terminator of the ACTN gene in the tardigrade Hypsibius dujardini. Actin is a protein involved in the formation of the filaments of muscle cells as well as cell mobility and contraction. false false _2597_ 32302 32302 9 false Includes the 3' UTR. false David Sanderson BBa_K2128009_sequence 1 gttcatggttcatacctgggtcatcttttccctgttggccttggggttgaggggagcctcagtcaggaggacggggtgttcctcgggagccacgcggagctcgttgtagaaggtgtgatgccagatcttctccatgtcatcccagttggtgacgatgccgtgctcgatggggtacttgagcgtcaggataccgcgcttgctctgggcctcatcaccgacgtagctgtccttttgacccataccgaccatgacaccctacaaggtaacacggaggcaaatgtcaatcagtcacacccagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z