BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2128002 1 BBa_K2128002 HDLEA3 2016-08-12T11:00:00Z 2016-08-13T11:25:38Z H. Dujardini This part is a member is a class of intrinsically disordered proteins called the Late Embryonic Abundant (LEA) proteins that become ordered when desiccated, thereby stabilizing DNA and protein cell components. It was taken from the genome of H. Dujardini and optimized by the IDT Codon Optimization Tool for E. Coli K12. false false _2597_ 32302 32302 9 false This part has been optimized by the IDT Codon Optimization Tool for E. Coli K12. false David Sanderson annotation2481452 1 HDLEA3_ORF range2481452 1 1 528 BBa_K2128102 1 BBa_K2128102 Strong promoter/RBS for HDLEA3 2016-10-15T11:00:00Z 2016-10-16T11:53:00Z The coding sequence of this composite part is a member of a class of intrinsically disordered proteins called the Late Embryonic Abundant (LEA) proteins that become ordered when desiccated, thereby stabilizing DNA and protein cell components. It was taken from the genome of H. Dujardini and optimized by the IDT Codon Optimization Tool for E. Coli K12. A strong promoter and strong ribosome binding site were placed upstream of HDLEA3. false false _2597_ 31725 31725 9 false We have attempted to maximize expression of HDLEA3. false Kathryn Flanagan component2513044 1 BBa_K2128002 component2513042 1 BBa_K880005 annotation2513044 1 BBa_K2128002 range2513044 1 62 589 annotation2513042 1 BBa_K880005 range2513042 1 1 55 BBa_K880005 1 BBa_K880005 Strong promoter, strong RBS combination for high expression levels of proteins 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z It is a combination of strong promoter (J23100) and RBS (B0034). Released HQ 2013 -J23100+B0034 -Strong promoter, strong RBS combination for high expression levels of proteins Consensus constitutive promoter and RBS sequence-produces strongest possible expression. false false _1142_ 0 9403 9 In stock false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204230 1 BBa_B0034 component2204228 1 BBa_J23100 annotation2204228 1 BBa_J23100 range2204228 1 1 35 annotation2204230 1 BBa_B0034 range2204230 1 44 55 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K2128102_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgcgtcaaggcattctgattgcgttcttcgtcgtcgcgttacttagcggagggtgtttagcaaaaaaagagaaaactgttacagaggctgctgaagaggtgctggaagacgtgaaagaggcagcgggggacgcctacaacgccgcgaagcacaaagtggaagattggaaagaggacgctgaggaaatgtacgaggatttggaggaaagtgcaaaggagcgttggacgcagacgcgccaccaagctaaggaagttaaggatagtgctgacaagaagtttcaagctgtcaaggagtccgtagaggataccgttgaagtggcaaaacaaaaggctgaagaacttaaaaagtcggctgagaaaaccgcgagcaaagtaaaggatgcggcgaaagaaaaattacgtgaggcaaagaaatcaacgcttaaagctgagaaaactttttttgatacattttgggattactacaataagttgacttcgttcgtccttatcaagtttaaggagatccgtaagcgtattggttattag BBa_K2128002_sequence 1 atgcgtcaaggcattctgattgcgttcttcgtcgtcgcgttacttagcggagggtgtttagcaaaaaaagagaaaactgttacagaggctgctgaagaggtgctggaagacgtgaaagaggcagcgggggacgcctacaacgccgcgaagcacaaagtggaagattggaaagaggacgctgaggaaatgtacgaggatttggaggaaagtgcaaaggagcgttggacgcagacgcgccaccaagctaaggaagttaaggatagtgctgacaagaagtttcaagctgtcaaggagtccgtagaggataccgttgaagtggcaaaacaaaaggctgaagaacttaaaaagtcggctgagaaaaccgcgagcaaagtaaaggatgcggcgaaagaaaaattacgtgaggcaaagaaatcaacgcttaaagctgagaaaactttttttgatacattttgggattactacaataagttgacttcgttcgtccttatcaagtttaaggagatccgtaagcgtattggttattag BBa_K880005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z