BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2128000 1 BBa_K2128000 MAHS 2016-08-12T11:00:00Z 2016-10-21T02:49:49Z This part comes from H. Dugardini. This part is a member is a class of intrinsically disordered proteins called the Late Embryonic Abundant (LEA) proteins that become ordered when desiccated, thereby stabilizing DNA and protein cell components. false false _2597_ 32302 32302 9 false The coding sequence has been optimized for E. Coli K12 by the IDT Codon Optimization Tool. false David Sanderson annotation2481450 1 MAHS_ORF range2481450 1 1 711 BBa_K2128200 1 BBa_K2128200 MAHS with strong promoter/RBS 2016-10-18T11:00:00Z 2016-10-21T03:38:22Z MAHS was taken from the genome of Ramazzottius varieornatus and optimized by the IDT Codon Optimization Tool for E. Coli K12. A strong constitutive promoter (J23100) and strong ribosome binding site (B0034) have been placed upstream of the MAHS coding sequence in order to maximize expression of the protein to provide the ability to beter survive desiccation circumstances. false false _2597_ 32302 31725 9 false We have attempted to maximize expression of MAHS through use of a strong constitutive promoter (J23100) and strong ribosome binding site (B0034). false Team Genspace2016 component2521673 1 BBa_K880005 component2521675 1 BBa_K2128000 annotation2521675 1 BBa_K2128000 range2521675 1 62 772 annotation2521673 1 BBa_K880005 range2521673 1 1 55 BBa_K880005 1 BBa_K880005 Strong promoter, strong RBS combination for high expression levels of proteins 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z It is a combination of strong promoter (J23100) and RBS (B0034). Released HQ 2013 -J23100+B0034 -Strong promoter, strong RBS combination for high expression levels of proteins Consensus constitutive promoter and RBS sequence-produces strongest possible expression. false false _1142_ 0 9403 9 In stock false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204230 1 BBa_B0034 component2204228 1 BBa_J23100 annotation2204228 1 BBa_J23100 range2204228 1 1 35 annotation2204230 1 BBa_B0034 range2204230 1 44 55 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K2128200_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgagccgctaccttctgcgcgacgtacaggcggtactgcgcggcgtgcgcaaagtagccgaaagttcacttaaattagaaacagagaaggtatcactgcgcttgggggatttccgttcacaaccgagtttacgttcggtcccggcatcccttaccagccgtagtcaagcatttagtttacaagagattgccgcgcgtgctggcgtagttctgcgcggcgttcagcagcagtttcgcaatgtcaccggcgtaaatgcagcccctgtcgtcgcgttcgataacggaagcgtgctgtatagcgaacgtattcattcccagagcagtcagaagcaagcacctacaacagttccaacgggaagtgtttcaaattcaccgcagcctgagggaaaagctaatgaggcggcagagcgtgctaagcagttcatgaaccccccagtcgcccctatggatccagtagataagaatgagtttgtagcgatgccggaaatgggacgttccaatggtaacggggagaataaacaagcggcagacttcatgaagaatcaaggtgacacagatatggattcacaatacgcgcccgatagctcaaagaatacgaagtccgtgccgactaaggagattgtagcagaggatggtagcatgtctattgaggatatcaagaaagccacacaagtaactccaggcgttgcagtaaaaaacgaaggagtatag BBa_K880005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa BBa_K2128000_sequence 1 atgagccgctaccttctgcgcgacgtacaggcggtactgcgcggcgtgcgcaaagtagccgaaagttcacttaaattagaaacagagaaggtatcactgcgcttgggggatttccgttcacaaccgagtttacgttcggtcccggcatcccttaccagccgtagtcaagcatttagtttacaagagattgccgcgcgtgctggcgtagttctgcgcggcgttcagcagcagtttcgcaatgtcaccggcgtaaatgcagcccctgtcgtcgcgttcgataacggaagcgtgctgtatagcgaacgtattcattcccagagcagtcagaagcaagcacctacaacagttccaacgggaagtgtttcaaattcaccgcagcctgagggaaaagctaatgaggcggcagagcgtgctaagcagttcatgaaccccccagtcgcccctatggatccagtagataagaatgagtttgtagcgatgccggaaatgggacgttccaatggtaacggggagaataaacaagcggcagacttcatgaagaatcaaggtgacacagatatggattcacaatacgcgcccgatagctcaaagaatacgaagtccgtgccgactaaggagattgtagcagaggatggtagcatgtctattgaggatatcaagaaagccacacaagtaactccaggcgttgcagtaaaaaacgaaggagtatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z