BBa_K2136017 1 BBa_K2136017 F2A self-cleaving peptide sequence 2016-10-15T11:00:00Z 2016-10-16T04:57:34Z foot-and-mouth disease virus The foot-and-mouth disease virus (FMDV) self cleaving peptide sequence (VKQTLNFDLLKLAGDVESNPGP) is capable of undergoing selfcleavage in vitro, thus separating 2 different in-frame peptide sequences. (1) Another peptide of the family, P2A, was more deeply characterized by iGEM14_Warwick (http://parts.igem.org/Part:BBa_K1442039#) References: Ryan M, King A, Thomas G. J. Gen. Virol. 72(11):2727-2732 doi:10.1099/0022-1317-72-11-2727 false false _2606_ 0 31704 31704 9 Not in stock false Nothing to add. false Tiago Lubiana Alves BBa_K2136017_sequence 1 gtgaagcagaccctgaacttcgacctgctgaagctggcgggcgacgtggagagcaacccgggcccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z