BBa_K2136018 1 BBa_K2136018 Ars2 signal peptide for secretion in Chlamydomonas 2016-10-15T11:00:00Z 2016-10-16T05:43:20Z It comes from the gene sequence for arylsuflatase 2 (Ars2) gene in Chlamydomonas reinhardtii. This sequence is part of the arylsuflatase 2 (Ars2) gene in Chlamydomonas reinhardtii. It is responsible for allowing the secretion of the fused protein to the culture medium, thus allowing cell-lysys independent purification of proteins and/or secretion for other aplications false false _2606_ 0 31704 31704 9 Not in stock false Nothing to add. false Tiago Lubiana Alves annotation2513575 1 F2A peptide range2513575 1 1 78 annotation2513574 1 scar with XhoI and ClaI sites range2513574 1 79 91 BBa_K2136018_sequence 1 atgcatgcacgcaagatgggtgccctcgcggtgctcgccgtcgcttgcctcgcggcagtggcatcggttgcgcatgcgatcgatctcgagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z