BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K2139012 1 BBa_K2139012 SLAC with Terminator 2016-10-13T11:00:00Z 2016-10-30T04:01:10Z PCR amplified out of genome. It is a small 229 amino acid protein requiring four copper ions per monomer as cofactors. Its function is to oxidize a range of substrates including phenols, aromatic amines, and nonphenolic substrates involved in lignin degradation. The GenBank number is WP_020416648 (amino acid) with a PDB of 3T9W_A. false false _2609_ 33491 34108 9 false Amycolatopsis sp. 75iv2 false UBC iGEM 2016 component2501033 1 BBa_K2139004 component2501040 1 BBa_B0015 annotation2501040 1 BBa_B0015 range2501040 1 699 827 annotation2501033 1 BBa_K2139004 range2501033 1 1 690 BBa_K2139004 1 BBa_K2139004 Coding Sequence of SLAC 2016-10-13T11:00:00Z 2016-10-30T03:56:04Z Amycolatopsis sp. 75iv2 BBA_K2139004 is the coding region of SLAC (Small LACcase). It is a small 229 amino acid protein requiring four copper ions per monomer as cofactors. Its function is to oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates involved in lignol degradation. The GenBank number is of a protein homolog (single insertion of Lysine at amino acid 220)is WP_020416648 (amino acid) with a PDB of 3T9W_A. false false _2609_ 33491 34108 9 false PCR amplified out of genome. false UBC iGEM 2016 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2139004_sequence 1 atgcagggcacgacccggcggatcacgatgtacgccgagaagatctccgacgagctgtacggctacgggctcgcgcccggcggggcgacggtgcccgggccggtgctggagatgtgggagggcgacaccctcgagatcgacctggtcaacacgaccgaccgggtgctgtcgctgcacccgcacggcgtcgactacgacgtgaactccgacggcaccctgatgaacgggtccgcggtgatgcccggccagacccggcgctacacctggcgcagtcacgtgggttaccggcgggcggacgggtcgtgggccgagggcacggcgggctactggcactaccacgaccacgcgatgggcaccgagcacggcaccgagggcgtgctcaagggcctgtacggggcgctggtggtgcggcggcagggcgatctgcttccgaagcggcagttcaccgtggtgttcaacgacatgatgatcaacaaccgggcgcaccacgacgcgccgacgttcgaggcgaacctcggcgagcgggtggagtggatcgcgatcgggcacggcagcaacttccacaccttccacctgcacgggcaccgctggctggacaaccggaccggcatgcgcaccagcgagtacgacccgagcccgctgatcgacatcaaagacctcaaccccggggtgtcgttcgggttccagtga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2139012_sequence 1 atgcagggcacgacccggcggatcacgatgtacgccgagaagatctccgacgagctgtacggctacgggctcgcgcccggcggggcgacggtgcccgggccggtgctggagatgtgggagggcgacaccctcgagatcgacctggtcaacacgaccgaccgggtgctgtcgctgcacccgcacggcgtcgactacgacgtgaactccgacggcaccctgatgaacgggtccgcggtgatgcccggccagacccggcgctacacctggcgcagtcacgtgggttaccggcgggcggacgggtcgtgggccgagggcacggcgggctactggcactaccacgaccacgcgatgggcaccgagcacggcaccgagggcgtgctcaagggcctgtacggggcgctggtggtgcggcggcagggcgatctgcttccgaagcggcagttcaccgtggtgttcaacgacatgatgatcaacaaccgggcgcaccacgacgcgccgacgttcgaggcgaacctcggcgagcgggtggagtggatcgcgatcgggcacggcagcaacttccacaccttccacctgcacgggcaccgctggctggacaaccggaccggcatgcgcaccagcgagtacgacccgagcccgctgatcgacatcaaagacctcaaccccggggtgtcgttcgggttccagtgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z