BBa_K1813037 1 BBa_K1813037 ptac and RBS 2015-09-10T11:00:00Z 2015-09-18T07:18:03Z Registry ptac RBS false false _2238_ 25865 12892 9 false NA false UBC iGEM 2015 component2449459 1 BBa_B0034 component2449457 1 BBa_K864400 annotation2449459 1 BBa_B0034 range2449459 1 70 81 annotation2449457 1 BBa_K864400 range2449457 1 1 61 BBa_K2139018 1 BBa_K2139018 Coding Sequence of G12 2016-10-13T11:00:00Z 2016-10-30T04:05:24Z Acidothermus cellulolyticus BBa_K2139018 encompass the coding region for an endo-beta-1,4-glucanase known as G12. G12 catalyzes the conversion of cellulose into smaller fragments by making internal cuts in the cellulose chain. It can be used in conjunction with exoglucanases for the direct conversion of cellulose into monomeric glucose. The polymerization of the protein is monomeric with an optimal temperature of 50 degrees Celsius and an optimal pH ranging from 6 to 8. The genbank ascension number for this protein is ABK52392.1 (amino acid) and a PDB code of 1H0B_A (homolog). Literature data for this part can be found http://aem.asm.org/content/76/19/6360.full false false _2609_ 33491 34108 9 false Codon optimized to for E.coli. false UBC iGEM 2016 BBa_K2139013 1 BBa_K2139013 Ptac with g12 2016-10-13T11:00:00Z 2016-10-30T04:02:56Z It is codon optimized for Caulobacter cresentus, exhibiting a high GC content. Endo5a catalyzes the conversion of cellulose into smaller fragments by making internal cuts in the cellulose chain. It can be used in conjunction with exoglucanases for the direct conversion of cellulose into monomeric glucose. The polymerization of the protein is monomeric with an optimal temperature of 50 degrees Celsius and an optimal pH ranging from 6 to 8. The genbank ascension number for this protein is HQ657203.1 (DNA), AEB00655.1 (amino acid), and a PDB code of 1VRX. This construct was synthesized for use in Caulobacter Cresentus and is codon optimized to contain a high GC content. Literature data for this part can be found http://www.sciencedirect.com/science/article/pii/S1046592812003154 false false _2609_ 33491 34108 9 false Paenibacillus strain ICGEB2008 false UBC iGEM 2016 component2527470 1 BBa_K2139018 component2527469 1 BBa_K1813037 annotation2527470 1 BBa_K2139018 range2527470 1 88 990 annotation2527469 1 BBa_K1813037 range2527469 1 1 81 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K864400 1 BBa_K864400 Ptac, trp & lac regulated promoter 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Created from oligos ordered from SigmaAldrich. Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG Released HQ 2013 The Ptac promoter is a functional hybrid promoter, derived from the trp and lac promoters, that are regulated by trp and lac [1]. This part also exist together with lacI, part [[Part:BBa_K180000|BBa_K180000]] [1] Proc. Natl. Acad. Sci. USA, Vol. 80, pp. 21-25 false false _1124_ 0 9827 9 In stock false Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone. false Erik Lundin annotation2197237 1 -35 range2197237 1 7 12 annotation2197238 1 -10 range2197238 1 29 33 annotation2197236 1 Ptac range2197236 1 1 40 annotation2197240 1 lacO1 site range2197240 1 36 61 BBa_B0034_sequence 1 aaagaggagaaa BBa_K2139013_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttactagagaaagaggagaaatactagatgttagtgttaagagccccacgctggagagtggtcataacggctgccgctgtgggcattgccgccgctggcatcctggttacttcgcactcagcttacggggcgacgacctccacgtgtagcccaaccgctgtcgtcagtgtagccggtgatgagtatcgcgttcaggcgaacgaatggaatagctcagctcaacaatgcttgacaatagataccagtacaggggcgtggtcggtatccacagccaatttcaatttggccacaaacggcgcaccggcgacctacccgtctatttataagggatgccattgggggaattgcacgactgccaacgtaggtatgcctatacaagtatcaaagattggatcggctgtaacaagttggtccacgactcaggtgtcgagcggagcttacgacgtggcttatgacatctggacaaactctactcccaccacatccggacaacccaacggcactgaggtgatgatttggttgaactcacgtggcggggtacaaccctttgggtcccaaactgcgactggcgtgaccgtcgcgggtcatacgtggaatgtatggcagggccaacaaacctcttggaagataatatcgtacgtattaactccaggggctacgtctataagcaatctggatcttaaggctatcttagcagatgctgccgcgcggggcagccttaacacgtcggactacttaattgacgtggaggcgggttttgaaatctggcagggtggacagggattagggagcaatagtttctcggtctccgttacaagtggtacctcatcgcctactcccaccccctcaccgtccccttcgccctcacccgcccctagtccatctcctagcccctctccgacacctaccagtagtcctacttcgtcgtag BBa_K1813037_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttactagagaaagaggagaaa BBa_K2139018_sequence 1 atgttagtgttaagagccccacgctggagagtggtcataacggctgccgctgtgggcattgccgccgctggcatcctggttacttcgcactcagcttacggggcgacgacctccacgtgtagcccaaccgctgtcgtcagtgtagccggtgatgagtatcgcgttcaggcgaacgaatggaatagctcagctcaacaatgcttgacaatagataccagtacaggggcgtggtcggtatccacagccaatttcaatttggccacaaacggcgcaccggcgacctacccgtctatttataagggatgccattgggggaattgcacgactgccaacgtaggtatgcctatacaagtatcaaagattggatcggctgtaacaagttggtccacgactcaggtgtcgagcggagcttacgacgtggcttatgacatctggacaaactctactcccaccacatccggacaacccaacggcactgaggtgatgatttggttgaactcacgtggcggggtacaaccctttgggtcccaaactgcgactggcgtgaccgtcgcgggtcatacgtggaatgtatggcagggccaacaaacctcttggaagataatatcgtacgtattaactccaggggctacgtctataagcaatctggatcttaaggctatcttagcagatgctgccgcgcggggcagccttaacacgtcggactacttaattgacgtggaggcgggttttgaaatctggcagggtggacagggattagggagcaatagtttctcggtctccgttacaagtggtacctcatcgcctactcccaccccctcaccgtccccttcgccctcacccgcccctagtccatctcctagcccctctccgacacctaccagtagtcctacttcgtcgtag BBa_K864400_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z