BBa_K2139014 1 BBa_K2139014 g12 with Terminator 2016-10-13T11:00:00Z 2016-10-30T04:03:33Z Codon optimized for Caulobacter crescentus (high GC content). Gluc1C is a monomeric enzyme capable of catalyzing the conversion of cellobiose into monomeric glucose at the non reducing end of the sugar polymer. It can be used in conjunction with an endoglucanase for the direct conversion of cellulose into monomeric glucose. The genbank ascension number for this protein is JQ713769.1 (DNA), AFQ36783.1 (amino acid), and a PDB code of 2O9R_A. This construct was synthesized for use in Caulobacter cresentus and is codon optimized to contain a high GC content. Literature data for this part can be found http://www.sciencedirect.com/science/article/pii/S1046592812003154 false false _2609_ 33491 34108 9 false Paenibacillus sp. MTCC 5639 false UBC iGEM 2016 component2527347 1 BBa_K2139018 component2527354 1 BBa_B0015 annotation2527354 1 BBa_B0015 range2527354 1 912 1040 annotation2527347 1 BBa_K2139018 range2527347 1 1 903 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2139018 1 BBa_K2139018 Coding Sequence of G12 2016-10-13T11:00:00Z 2016-10-30T04:05:24Z Acidothermus cellulolyticus BBa_K2139018 encompass the coding region for an endo-beta-1,4-glucanase known as G12. G12 catalyzes the conversion of cellulose into smaller fragments by making internal cuts in the cellulose chain. It can be used in conjunction with exoglucanases for the direct conversion of cellulose into monomeric glucose. The polymerization of the protein is monomeric with an optimal temperature of 50 degrees Celsius and an optimal pH ranging from 6 to 8. The genbank ascension number for this protein is ABK52392.1 (amino acid) and a PDB code of 1H0B_A (homolog). Literature data for this part can be found http://aem.asm.org/content/76/19/6360.full false false _2609_ 33491 34108 9 false Codon optimized to for E.coli. false UBC iGEM 2016 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2139018_sequence 1 atgttagtgttaagagccccacgctggagagtggtcataacggctgccgctgtgggcattgccgccgctggcatcctggttacttcgcactcagcttacggggcgacgacctccacgtgtagcccaaccgctgtcgtcagtgtagccggtgatgagtatcgcgttcaggcgaacgaatggaatagctcagctcaacaatgcttgacaatagataccagtacaggggcgtggtcggtatccacagccaatttcaatttggccacaaacggcgcaccggcgacctacccgtctatttataagggatgccattgggggaattgcacgactgccaacgtaggtatgcctatacaagtatcaaagattggatcggctgtaacaagttggtccacgactcaggtgtcgagcggagcttacgacgtggcttatgacatctggacaaactctactcccaccacatccggacaacccaacggcactgaggtgatgatttggttgaactcacgtggcggggtacaaccctttgggtcccaaactgcgactggcgtgaccgtcgcgggtcatacgtggaatgtatggcagggccaacaaacctcttggaagataatatcgtacgtattaactccaggggctacgtctataagcaatctggatcttaaggctatcttagcagatgctgccgcgcggggcagccttaacacgtcggactacttaattgacgtggaggcgggttttgaaatctggcagggtggacagggattagggagcaatagtttctcggtctccgttacaagtggtacctcatcgcctactcccaccccctcaccgtccccttcgccctcacccgcccctagtccatctcctagcccctctccgacacctaccagtagtcctacttcgtcgtag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2139014_sequence 1 atgttagtgttaagagccccacgctggagagtggtcataacggctgccgctgtgggcattgccgccgctggcatcctggttacttcgcactcagcttacggggcgacgacctccacgtgtagcccaaccgctgtcgtcagtgtagccggtgatgagtatcgcgttcaggcgaacgaatggaatagctcagctcaacaatgcttgacaatagataccagtacaggggcgtggtcggtatccacagccaatttcaatttggccacaaacggcgcaccggcgacctacccgtctatttataagggatgccattgggggaattgcacgactgccaacgtaggtatgcctatacaagtatcaaagattggatcggctgtaacaagttggtccacgactcaggtgtcgagcggagcttacgacgtggcttatgacatctggacaaactctactcccaccacatccggacaacccaacggcactgaggtgatgatttggttgaactcacgtggcggggtacaaccctttgggtcccaaactgcgactggcgtgaccgtcgcgggtcatacgtggaatgtatggcagggccaacaaacctcttggaagataatatcgtacgtattaactccaggggctacgtctataagcaatctggatcttaaggctatcttagcagatgctgccgcgcggggcagccttaacacgtcggactacttaattgacgtggaggcgggttttgaaatctggcagggtggacagggattagggagcaatagtttctcggtctccgttacaagtggtacctcatcgcctactcccaccccctcaccgtccccttcgccctcacccgcccctagtccatctcctagcccctctccgacacctaccagtagtcctacttcgtcgtagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z