BBa_K2140000 1 BBa_K2140000 StarScafold Prototype 1 2016-10-11T11:00:00Z 2016-10-12T09:58:15Z This part is a composite of artificial and natural DNA. The Leucine Zipper, Cystine and Linker regions were all rationally designed. The inteins found at the ends of the StarScaffolds are a combination of genomic engineered and genomic DNA as described in [1][2][3]. 1. Stevens, A. J., Brown, Z. Z., Shah, N. H., Sekar, G., Cowburn, D., & Muir, T. W. (2016). Design of a Split Intein with Exceptional Protein Splicing Activity. Journal of the American Chemical Society, 138(7), 2162-2165. 2. Carvajal-Vallejos, P., Palliss??, R., Mootz, H. D., & Schmidt, S. R. (2012). Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. Journal of Biological Chemistry, 287(34), 28686-28696. 3. Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O., & Pietrokovski, S. (2009). Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic acids research, gkp095. These two parts contain the gene sequence for our Prototype StarScaffold. These prototypes contain a single 5 repeat antiparallel leucine zipper for dimerisation as well as a set of four inteins, which were chosen to cover a range of active temperatures. This allows the progressive build-up of macromolecular structures in an effort to form proteinaceous monolayers, filaments and potentially more complicated structures. Each segment is bookended by flexible linkers to prevent steric hinderance of segment folding. This is particularly a concern for the natural split inteins found at each end of the protein as they form a folded structure before interacting. However the same is not true for the artificial split inteins which should be more amenable to internal protein segments as this is part of their native full intein structure. false false _2610_ 31465 31465 9 false Linker length: Is there enough room between each leucine zipper and intein so they may both fold? Intein placement, which inteins are most likely to fold spontanously false Robert Ashley Naturani annotation2495742 1 ATG (Second half of NdeI) range2495742 1 1045 1047 BBa_K2140000_sequence 1 gccttgaaagtaaaggttttcagaaccacctccacccttggcacgactacgtaaaaagtcacctaccttcagtcctgagttgatggttttaagaccgtctttcgttgggaacttatgattcgcggagacgcgaatcttcttcccagacttggatttcaatacgatctcaaatactggctgcttaatgatcggcaacacttcagtcacctgcacaggtccacactctgactccagccaatctccaacctttacgtcgcgaatctcgattgccttcccgtttgtgacgaccatggtatctaaggataagcaacggttcaattgcgaacttccaccacctccttgcgccaacttttttttaagttgcgccagttttttcttaagcgcttgcagtttccactttaactgagcaagcttcttcttgttagcctgaagctttttttttaattgagcccctcctttacgcccgcaaccgcgtttaccaccattaaaacaattcgatgctaccaggccattcttcaataagaagttatgatctttctctacaccaatatcgtatacgttctgcgtgccaagtgatttacgtgaaataattttaaccatggagcctcccccgcctggaccctggaataacacttccaaagaccccccgccaccagccaggcgtttataaagatcctcaatcttaatctttccatcctctgtctctaccatggtgtctccgtaaacgcactcaaactccacctttgaccctccccctcccccgcctttgcgaccgcagccgcgtttaccaccttgggccagctctttttcaagttgggcattctccttctctaaagcctgcaactcccactcaagttgtgccaactccttttccagagcctgtaactccttttcaagctgcgcggagccaccccctccgacatctgaagacgagctgttatgggtcaagatatcattagcataaaacaaatgatttcctgatacttcaatatcaattaattcgcgctcatccaattcttcgatcttcaaaattttcttcaacatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z