BBa_K2140002 1 BBa_K2140002 StarScaffold Prototype 1 2016-10-11T11:00:00Z 2016-10-12T10:12:28Z The Leucine Zipper, Linker and Cystine regions we're designed denovo from the literature, while The inteins are a combination of engineered and non-engineered genomic gene segments. 1. Stevens, A. J., Brown, Z. Z., Shah, N. H., Sekar, G., Cowburn, D., & Muir, T. W. (2016). Design of a Split Intein with Exceptional Protein Splicing Activity. Journal of the American Chemical Society, 138(7), 2162-2165. 2. Carvajal-Vallejos, P., Palliss??, R., Mootz, H. D., & Schmidt, S. R. (2012). Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. Journal of Biological Chemistry, 287(34), 28686-28696. 3. Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O., & Pietrokovski, S. (2009). Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic acids research, gkp095. This is one of the pair of Prototype StarScaffold proteins. These prototypes contain a single 5 repeat antiparallel leucine zipper for dimerisation as well as a set of four inteins, which were chosen to cover a range of active temperatures. This allows the progressive build-up of macromolecular structures in an effort to form proteinaceous monolayers, filaments and potentially more complicated structures. Each segment is bookended by flexible linkers to prevent steric hinderance of segment folding. This is particularly a concern for the natural split inteins found at each end of the protein as they form a folded structure before interacting. However the same is not true for the artificial split inteins which should be more amenable to internal protein segments as this is part of their native full intein structure. false false _2610_ 31465 31465 9 false Linker and zipper length was considered heavily and decided upon by a combination of value from the literature and advice from the advisors. false Robert Ashley Naturani BBa_K2140002_sequence 1 gccttgaaagtaaaggttttcagaaccacctccacccttggcacgactacgtaaaaagtcacctaccttcagtcctgagttgatggttttaagaccgtctttcgttgggaacttatgattcgcggagacgcgaatcttcttcccagacttggatttcaatacgatctcaaatactggctgcttaatgatcggcaacacttcagtcacctgcacaggtccacactctgactccagccaatctccaacctttacgtcgcgaatctcgattgccttcccgtttgtgacgaccatggtatctaaggataagcaacggttcaattgcgaacttccaccacctccttgcgccaacttttttttaagttgcgccagttttttcttaagcgcttgcagtttccactttaactgagcaagcttcttcttgttagcctgaagctttttttttaattgagcccctcctttacgcccgcaaccgcgtttaccaccattaaaacaattcgatgctaccaggccattcttcaataagaagttatgatctttctctacaccaatatcgtatacgttctgcgtgccaagtgatttacgtgaaataattttaaccatggagcctcccccgcctggaccctggaataacacttccaaagaccccccgccaccagccaggcgtttataaagatcctcaatcttaatctttccatcctctgtctctaccatggtgtctccgtaaacgcactcaaactccacctttgaccctccccctcccccgcctttgcgaccgcagccgcgtttaccaccttgggccagctctttttcaagttgggcattctccttctctaaagcctgcaactcccactcaagttgtgccaactccttttccagagcctgtaactccttttcaagctgcgcggagccaccccctccgacatctgaagacgagctgttatgggtcaagatatcattagcataaaacaaatgatttcctgatacttcaatatcaattaattcgcgctcatccaattcttcgatcttcaaaattttcttcaacatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z