BBa_K214002 1 BBa_K214002 Mature Atrial Natriuretic Peptide (ANP) 2009-10-18T11:00:00Z 2015-05-08T01:11:29Z Genbank precursor sequence, modified to include only the amino acids present in the mature sequence. Mature Atrial Natriuretic Peptide (ANP). No start codon present in mature sequence. false false _316_ 0 4135 9 It's complicated false Removed amino acids that were cleaved off of precursor. false QGEM_09 annotation2054853 1 Mature ANP Protein range2054853 1 1 87 BBa_K214002_sequence 1 agcctgcggagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactgggctgtaacagcttccggtactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z