BBa_K2142003 1 BBa_K2142003 mazF toxin 2016-10-06T11:00:00Z 2016-10-07T08:47:27Z E.coli This part forms in combination with the part BBa_K2142001 toxin/antitoxin system for selection. This toxin digest mRNA so that E.coli can nor grow anymore. We used it in combination with the antitoxin to let bacteria fight against each other. false false _2612_ 29777 29777 9 false The problem with this part is that e.coli does not like to produce toxic stuff so we combined it with a strong promoter which can be induced. false Lukas Rieder BBa_K2142003_sequence 1 atggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttatacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaaacgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z