BBa_K1104301 1 BBa_K1104301 Defensin1 2013-09-10T11:00:00Z 2015-05-08T01:09:10Z ''Apis melliferra'' Defensin1 false false _1415_ 0 16321 9 In stock true None false Jou-Chien Liao, Rohan Shina, Yucheng Huang annotation2363581 1 Methionine range2363581 1 1 3 annotation2363644 1 mature peptide range2363644 1 4 159 annotation2363582 1 Term range2363582 1 160 162 BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2129433 1 RBS range2129433 1 24 27 annotation2127788 1 B0034 range2127788 1 21 32 BBa_K2144003 1 BBa_K2144003 Coding sequence for Defensin regulated by T7-promoter 2016-10-11T11:00:00Z 2016-10-19T10:02:05Z - Coding sequence for Defensin regulated by T7-promoter. The function of defensin is to lyse the pathogenic cell by permeabilizing the plasma membrane. false false _2614_ 31370 31517 9 false Made by 3A assembly false Oskar ??hman component2493593 1 BBa_K525998 component2493597 1 BBa_K1104301 annotation2493597 1 BBa_K1104301 range2493597 1 39 200 annotation2493593 1 BBa_K525998 range2493593 1 1 32 BBa_K2144003_sequence 1 taatacgactcactatagggaaagaggagaaatactagatggtaacttgtgaccttctctcattcaaaggacaagttaatgacagtgcttgcgctgctaactgtctcagtttgggtaaagctggaggtcattgcgagaaaggagtttgtatttgtcgaaaaaccagtttcaaagatctctgggacaaacgtttcggttaa BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K1104301_sequence 1 atggtaacttgtgaccttctctcattcaaaggacaagttaatgacagtgcttgcgctgctaactgtctcagtttgggtaaagctggaggtcattgcgagaaaggagtttgtatttgtcgaaaaaccagtttcaaagatctctgggacaaacgtttcggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z