BBa_K2144009 1 BBa_K2144009 Sequence for His6-tag and LPXTGG-tag 2016-10-11T11:00:00Z 2016-10-12T02:35:45Z Coming soon The His6-tag enables purification of proteins with IMAC. The LPXTG-tag enables the use of the "match making" enzyme sortase. The key feature of sortasee is the specific conjugation reaction it carries out, where the enzyme recognizes a specific amino acid sequence, a so called sorting motif (LPXTG motif in the case of S.aureus) and conjugate this sequence with another unit carrying an oligo glycine motif. false false _2614_ 31517 31517 9 false Coming soon false Oskar ??hman annotation2493493 1 Linker range2493493 1 1 14 annotation2493494 1 LPXTG range2493494 1 15 31 annotation2493495 1 His6 range2493495 1 32 48 BBa_K2144009_sequence 1 ggcggcggcggcagccttcctgaaactggcggccaccaccaccaccaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z