BBa_K2144100 1 BBa_K2144100 Coding sequence for Nuclease with His6 and LPXTG-tag regulated by T7-promoter 2016-10-11T11:00:00Z 2016-10-12T03:02:53Z Nuclease is found in S.Aureus. The LT-sequence is ordered from IDT. Coding sequence for Nuclease from Staphylococcus Aureus, regulated by T7-promoter. This enzyme has the ability to cleave DNA. The inserted LT-sequence contain the gene encoding for His-tag which enables the use of IMAC to purify the combat protein. Furthermore it contains the LXPTG-tag which enables the use of the "match making" enzyme Sortase. The key feature of sortase is the specific conjugation reaction it carries out, where the enzyme recognizes a specific amino acid sequence, a so called sorting motif (LPXTG motif in the case of S.aureus) and conjugate this sequence with another unit carrying an oligo glycine motif. A new peptide bond is formed. The Linker in the LT-sequence enables proper folding of the protein. false false _2614_ 31517 31517 9 false The LT-sequence was inserted with Overhang PCR. false Oskar ??hman component2493516 1 BBa_K2144000 component2493520 1 BBa_K2144009 annotation2493520 1 BBa_K2144009 range2493520 1 608 658 annotation2493516 1 BBa_K2144000 range2493516 1 1 599 BBa_K729004 1 BBa_K729004 Nuclease from Staphylococcus aureus 2012-06-29T11:00:00Z 2015-05-08T01:13:05Z - Nuclease from Staphylococcus aureus. Sequence pending. false false _975_ 0 11516 9 In stock false - false Bouran Sohrabi BBa_K2144009 1 BBa_K2144009 Sequence for His6-tag and LPXTGG-tag 2016-10-11T11:00:00Z 2016-10-12T02:35:45Z Coming soon The His6-tag enables purification of proteins with IMAC. The LPXTG-tag enables the use of the "match making" enzyme sortase. The key feature of sortasee is the specific conjugation reaction it carries out, where the enzyme recognizes a specific amino acid sequence, a so called sorting motif (LPXTG motif in the case of S.aureus) and conjugate this sequence with another unit carrying an oligo glycine motif. false false _2614_ 31517 31517 9 false Coming soon false Oskar ??hman annotation2493493 1 Linker range2493493 1 1 14 annotation2493495 1 His6 range2493495 1 32 48 annotation2493494 1 LPXTG range2493494 1 15 31 BBa_K2144000 1 Nuc-T7 Coding sequence for Nuclease regulated by T7-promoter 2016-09-21T11:00:00Z 2016-10-19T01:52:24Z Nuclease from Staphylococcus Aureus. Usage: Nuclease is an enzyme with the capability of cleaving phosphodiester bonds between nucleotides in DNA. This enzyme can be used in applications concerning degradation of DNA. In our project the aim was to evaluate and use Nuclease degrading abilities to inhibit the biofilm formation produced by Staphyloccus Auerus. The encoding part of the BioBrick is derived from BBa_K729004, made by iGEM London 2012. The T7 promoter (BBa_k525998) has been inserted to control protein expession under IPTG induction. To regulate the protein expression under T7 promoter control, E.coli containing a T7 polymerase must be used, for instance BL21(DE3). Biology: Nuclease is an extracellular enzyme found in Staphyloccus Aureus. [3] S.Aureus encodes for two Nucleases, Nuc1 and Nuc2, [3] whereof the last-mentioned is a part of this BioBrick. Nuc2 is connected to the membrane with a N-terminal anchor. [3] There are several bacterial pathogens using Nuclease to combat the immune response in the host by for instance avoiding neutrophil extracellular traps. (NETs). [1] Furthermore, since eDNA is an important component of biofilm [2] Nuc is able to work as a regulator of biofilm formation. [2] Studies have suggested that the expression of Nuc contributes to the inability to produce biofilm [2] and during biofilm formation-conditions the expression of Nuc is repressed. [3] false false _2614_ 31341 31517 9 false The subparts was aligned by 3A Assembly. false Oskar ??hman component2484439 1 BBa_K525998 component2484440 1 BBa_K729004 annotation2484439 1 BBa_K525998 range2484439 1 1 32 annotation2484440 1 BBa_K729004 range2484440 1 39 599 BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2129433 1 RBS range2129433 1 24 27 annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K2144100_sequence 1 taatacgactcactatagggaaagaggagaaatactagatgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgcaaacagataacggcgtaaatagaagtggttctgaagatccaacagtatatagtgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaataatactagagggcggcggcggcagccttcctgaaactggcggccaccaccaccaccaccac BBa_K2144009_sequence 1 ggcggcggcggcagccttcctgaaactggcggccaccaccaccaccaccac BBa_K729004_sequence 1 atgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgcaaacagataacggcgtaaatagaagtggttctgaagatccaacagtatatagtgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaataa BBa_K2144000_sequence 1 taatacgactcactatagggaaagaggagaaatactagatgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgcaaacagataacggcgtaaatagaagtggttctgaagatccaacagtatatagtgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z