BBa_K2148000 1 BBa_K2148000 psaA1 promoter + 5 2016-08-11T11:00:00Z 2016-10-04T06:11:25Z Chlamydomonas reinhardtii chloroplast genome Promoter and 5'UTR sequence for the psaA gene in Chlamydomonas reinhardtii chloroplast, flanked with the Phytobrick fusion sites for a promoter with 5'UTR part. Submitted in the universal acceptor vector (psB1C3), and can be extracted using Bsa1 to give the necessary Phytobrick fusion site overhangs for Golden Gate assembly to produce a transcriptional unit with other Phytobricks. false false _2618_ 33032 33032 9 false Added Phytobrick fusion sites to flank promoter 5'UTR sequence false Chern Juin Ong, Ciara McCarthy annotation2485807 1 5'UTR range2485807 1 150 283 annotation2485805 1 psaA1 promoter range2485805 1 5 149 annotation2485806 1 Phytbrick 5'UTR to CDS fusion site range2485806 1 284 287 annotation2485804 1 Phytobrick promoter prefix fusion site range2485804 1 1 4 BBa_K2148000_sequence 1 ggagtcttaattcaacatttttaagtaaatactgtttaatgttatacttttacgaatacacatatggtaaaaaataaaacaatatctttaaaataagtaaaaataatttgtaaaccaataaaaaatatatttatggtataatataacatatgatgtaaaaaaaactatttgtctaatttaataaccatgcattttttatgaacacataataattaaaagcgttgctaatggtgtaaataatgtatttattaaattaaataattgttattataaggagaaatccaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z