BBa_K2148015 1 BBa_K2148015 gRNA for AGG PAM 2016-10-12T11:00:00Z 2016-10-13T01:23:59Z Chlamydomonas reinhardtii This contains an sgRNA which has 20 nucleotide complementary sequences with the Chlamydomonas reinhardtii chloroplast genome upstream of the cut-site, which is at the trnE2-psbH integenic region with psaA promoter. This can be used together with Cas9 to perform site-specific cutting. This part is coded as a Promoter/5UTR/NTAG/CDS/CTAG Phytobrick. false false _2618_ 33032 33032 9 false The target sequence was generated by Alex Mayorov using Benchling software and the scaffold sequence was obtained from Addgene. false Chern Juin Ong annotation2499292 1 Promoter range2499292 1 5 149 annotation2499293 1 TSS range2499293 1 149 149 annotation2499294 1 Additional GG for stability range2499294 1 150 151 annotation2499297 1 gRNA scaffold range2499297 1 172 254 annotation2499296 1 target RNA range2499296 1 152 171 annotation2499298 1 Phytobrick fusion site range2499298 1 255 258 annotation2499291 1 Phytobrick fusion site range2499291 1 1 4 BBa_K2148015_sequence 1 ggagtcttaattcaacatttttaagtaaatactgtttaatgttatacttttacgaatacacatatggtaaaaaataaaacaatatctttaaaataagtaaaaataatttgtaaaccaataaaaaatatatttatggtataatataacatggaacgcgtttatcttaacggagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttgctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z