BBa_K2149001 1 BBa_K2149001 HPPD from Pseudomonas putida 2016-10-12T11:00:00Z 2016-10-13T06:51:59Z This part was taken from the genomic sequence from Pseudomonas putida (access number K00457) that is a gram-negative, rod-shaped, saprotrophic soil bacterium. This gene is involved in the carotenoids pathway and was courtesy as a part of an operon that produces tocotrienol by Dr. Albermann. This part coding a 4-hydroxyphenylpyruvate dioxygenase (HPPD) taken from Pseudomonas putida. This gene is involved in the pathway production of tocotrienol (vitamin E) and it is an oxygenase that catalyzes the second reaction in the catabolism of tyrosine - the conversion of 4-hydroxyphenylpyruvate into homogentisate (HGA). The HGA produced by 4-hydroxyphenylpyruvate dioxygenase that is one of many steps in break l-tyrosine into acetoacetate and fumarate. HPPD is part of a class of oxygenase enzymes that usually utilize α-ketoglutarate and diatomic oxygen to oxygenate or oxidize a target molecule. It is part of the cycle to create energy in almost aerobic organisms, but in eukaryotes, HPPD has a very important function that regulates blood tyrosine levels. Mutations in the N-terminal region of this protein cause the disease known as hawkinsinuria and HPPD can also be linked to one of the oldest known inherited metabolic disorders known as alkaptonuria. Plants utilize this enzyme to produce the cofactors plastoquinone and tocopherol which are essential for the plant to survive, this is why there are several HPPD inhibitor herbicides that block the activity of this enzyme and cause the plant's death. false false _2619_ 31199 31199 9 false The gene was synthesized with thirty nucleotides in its ends to do a Gibson Assembly overlap. false Aline Larissa Gon??alves annotation2500116 1 BBa_B0034 range2500116 1 27 39 annotation2500138 1 BBa_K2149001 range2500138 1 40 1117 BBa_K2149001_sequence 1 tcctcaacgacaggagcacgatcatgcaaagaggagaaaatggctgatatctttgaaaatccaatgggcctgatgggcttcgaattcatcgaactggcttcgccgaccccaggcgtactagagcctgtattccagatactgggcttcaccaaagtggccacccaccgttccaaggatgtgcacctgtatcgccagggtggcatcaacctgatcctgaacaatgaacccaagagcatcgcttcgtatttcgccgctgaacacggcccgtcggtatgtggcatggcttttcgcgtgcgcaatgcccatgaggcttatgcccgcgccctggaactgggcgctcagccggtagaaatcgaaaccggcccgatggaattgcgcctgccggcgatcaagggtatcgggggggcaccgctctatctgatcgaccgcttcgaggaaggcagctctatctacgacatcgacttcaacttcatcgaaggcgtggatcgcaacccggtaggggccggcctgaaaatcatcgaccacctcacccataacgtctaccgtgggcgtatggcctactgggccgggttctacgagaagctgttcaacttccgcgaaatccgctacttcgatatcaagggcgaatacaccggcctgacctccaaggccatgactgcgcctgatggcatgatccgcatcccgctcaacgaagagtcatccaagggtgcagggcagatcgaagagttcctgatgcagttcaacggtgaaggtatccagcacgtggccttcctgaccgatgacctgctcaagacctgggatgcgctgaaggggctgggcatgcgcttcatgaccgcgccaccgcaaacctactacgaaatgctcgaagagcgcctgccgggccatggtgagccggtcgaccaactgcaagcgcgtggcatcctgctcgatggcgcctcgcagcccggagacaagcgcctgctgctgcagattttctcggaaaccctgcttggcccggtcttcttcgagttcatccagcgcaaaggtgacgatggcttcggtgaaggcaacttcaaggcgctgttcgaatccatcgagcgtgaccaggtacgccgcggcgtgctgagcacagactgattggctccaattcttggagtggtgaatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z