BBa_K215001 1 BBa_K215001 Secretion Signal and Streptavidin Binding Tags 2009-09-29T11:00:00Z 2015-05-08T01:11:29Z Nanotag (bases 1-48): From Lamla and Erdmann (http://www.ncbi.nlm.nih.gov/pubmed/14680960). Secretion tag (last 181 AA): Gene Bank ID Erwinia chrysanthemi M60395.1 This part is the vector into which afp is inserted to tag it for purification using the IPP system. It contains an NheI restriction site that allows for the insertion of the desired protein coding sequence (NheI is compatible with XbaI and SpeI). This Target Vector part contains two tags: a secretion tag that causes the protein to be exported to the extracellular space, and a nanotag that causes the protein to bind to stretavidin (or some analog). For this part to function properly, it must be combined with a promoter and RBS, and used in E.coli strain UW5alpha, which has two other plasmids containing the other genes required for proper secretion and display of the protein to be purified on the outer membrane. false false _320_ 0 2811 9 It's complicated false NheI was chosen as the protein insertion site because it is compatible with digested XbaI and SpeI restriction sites. The TEV sites and HIS tags flanking the NheI site are present to separate the inserted protein from the added tags. GSA linkers were used to separate the various features of the part. false Jeff Nivala annotation2027598 1 GSA linker range2027598 1 178 186 annotation2027587 1 nanotag range2027587 1 1 48 annotation2027600 1 terminator (B0015) range2027600 1 736 865 annotation2027593 1 NheI range2027593 1 115 120 annotation2027595 1 TEV protease site range2027595 1 130 150 annotation2027594 1 GSA linker range2027594 1 121 129 annotation2027596 1 GSA linker range2027596 1 151 159 annotation2027590 1 GSA linker range2027590 1 76 84 annotation2027597 1 His tag range2027597 1 160 177 annotation2027592 1 GSA linker range2027592 1 105 114 annotation2027591 1 TEV protease site range2027591 1 85 104 annotation2027599 1 Secretion tag range2027599 1 187 735 annotation2027589 1 His tag range2027589 1 58 75 annotation2027588 1 GSA linker range2027588 1 49 57 BBa_K215001_sequence 1 atggacgttgaagcatggctgggtgcccgtgtaccgctggttgaaacgggcagcgcacatcaccaccatcatcatggttccgccgaaaacctctactttcagggcggctctgctgctagcggttctgccgagaatctgtacttccaaggtggctccgctcatcaccaccatcatcacggtagcgcaggcggcactgacacctttgacttctctggttactctaacaatcagcgtatcaacctgaacgagggttctttctctgacgttggtggtctgaagggcaacgtttctatcgcgcatggtgttaccatcgaaaacgcgatcggtggttctggtaacgacatcctgatcggtaatggcgcggataacatcctccagggtggtgcgggtgacgacgttctgtacggttctacgggtgcggacacgctgacgggtggcgctggtcgtgacattttcgtatatggtagcggtcaagactctaccgtttctgcatacgactggatcacggattttcagacgggtatcgacaaaatcgacctgtccgctttccgtaatgaaggtcagctgtcttttgttcaggaccagtttactggtaaaggccaggaggttatgctgcaatgggacgcggcgaactctacgaccaatctgtggctgcacgaagcgggtcactcttctgttgactttctcgttcgtatcgttggccagaccgcgcagagcgacattatcgtctaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z