BBa_C0079 1 lasr lasR activator from P. aeruginosa PAO1(+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Genbank: NC_002516 (www.ncbi.nlm.nih.gov) Released HQ 2013 coding region for lasR protein, which accepts chemical signal AI-1 (made by lasI protein) false false _1_ 0 24 7 In stock false Mutated 480 from g to a to remove PstI site true Alvin Carter Powers (Fighting Darwins) annotation308006 1 G range308006 1 480 480 annotation307948 1 LVA range307948 1 718 750 annotation307935 1 lasR range307935 1 1 717 annotation2213999 1 Help:Barcodes range2213999 1 757 781 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2150030 1 BBa_K2150030 pCon+pTet+pLas+RBS+ydcD+DT+pCon+RBS+lasR+DT 2016-10-12T11:00:00Z 2016-10-15T10:13:59Z PLas from BBa_R0079,LasR from BBa_C0079,ydcD from BBa_K733012 This part regulates the expression of antitoxin ydcD by adding or removing 3-oxo-dodecanoyl homoserine lactone (3O-C12-HSL). LasR is a transcription factor and is constitutively expressed. It can couple with 3O-C12-HSL and activate pLas, thus producing antitoxin. true false _2620_ 31283 31283 9 false planning false Jianyi Huang component2496330 1 BBa_B0015 component2496311 1 BBa_R0040 component2496331 1 BBa_J23119 component2496333 1 BBa_B0034 component2496345 1 BBa_B0015 component2496338 1 BBa_C0079 component2496323 1 BBa_K2150032 component2496320 1 BBa_R0079 component2496322 1 BBa_B0034 component2496310 1 BBa_J23119 annotation2496311 1 BBa_R0040 range2496311 1 44 97 annotation2496330 1 BBa_B0015 range2496330 1 582 710 annotation2496338 1 BBa_C0079 range2496338 1 780 1560 annotation2496322 1 BBa_B0034 range2496322 1 271 282 annotation2496345 1 BBa_B0015 range2496345 1 1569 1697 annotation2496320 1 BBa_R0079 range2496320 1 106 262 annotation2496333 1 BBa_B0034 range2496333 1 762 773 annotation2496310 1 BBa_J23119 range2496310 1 1 35 annotation2496331 1 BBa_J23119 range2496331 1 719 753 annotation2496323 1 BBa_K2150032 range2496323 1 289 573 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K2150032 1 ydcD ydcD(without RBS) 2016-10-12T11:00:00Z 2016-10-15T10:11:16Z PCR amplified from BBa_K733012 This part is the coding region for the antitoxin gene ydcD, without RBS. true false _2620_ 31283 31283 9 false It's easy to change RBS with different efficiency. false Jianyi Huang BBa_R0079 1 LasR+PAI Promoter (LasR & PAI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z "Analysis of the Pseudomonas aeruginosa Elastase (lasB) Regulatory Region". Lynn Rust, Everett Pesci, and Barbara Iglewski Released HQ 2013 Binding region for LasR protein (positive regulation) false true _1_ 0 24 7 In stock false true Alvin Carter Powers (Fighting Darwins) annotation300985 1 OP2 range300985 1 46 63 annotation318495 1 -35 range318495 1 117 122 annotation300992 1 OP1 range300992 1 106 125 annotation318496 1 -10 range318496 1 140 145 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K2150032_sequence 1 atgtctgaatccagcgcaagaaccgaaatgaaaatcagcttgcccgaaaacctagtagctgaattggatggtgtagcgatgcgggagaaacgaagcagaaacgaactgatatcacaagcagtgagagcgtatgtcagcgaacgaacaactcgtcacaaccgtgatttgatgagacgcggctatatggaaatggcgaaaatcaacctgaatatttcttctgaggctcactttgcggagtgcgaggctgaaacgacagttgagcgcttagtcagcggaggataatca BBa_C0079_sequence 1 atggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K2150030_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagctactagagaaagaggagaaatactagatgtctgaatccagcgcaagaaccgaaatgaaaatcagcttgcccgaaaacctagtagctgaattggatggtgtagcgatgcgggagaaacgaagcagaaacgaactgatatcacaagcagtgagagcgtatgtcagcgaacgaacaactcgtcacaaccgtgatttgatgagacgcggctatatggaaatggcgaaaatcaacctgaatatttcttctgaggctcactttgcggagtgcgaggctgaaacgacagttgagcgcttagtcagcggaggataatcatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0079_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z