BBa_K2150031 1 pT7 T7 promoter without RBS 2016-10-11T11:00:00Z 2016-10-12T09:06:12Z PCR amplified from BBa_K525998 This part is the T7 promoter without RBS. It has been reported that T7 promoter doesn't work with E.coli RNA polymerase, but only with T7 RNA polymerase(T7RNAP). However, we observed leakage of it in the absence of T7RNAP. false false _2620_ 31283 31283 9 false We deleted the RBS in BBa_K525998, so that RBS with different efficiency can be used. false Jianyi Huang BBa_K2150031_sequence 1 taatacgactcactataggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z