BBa_K215010 1 BBa_K215010 pLac+RBS+GFP with Secretion Signal and Streptavidin Binding Tags on GFP 2009-09-30T11:00:00Z 2015-05-08T01:11:30Z see K215001 for tag sources. This part is GFP with an N-terminus tag that binds to streptavidin and a C-terminus tag that signals for secretion to the extracellular space (when combined with proper secretion system BBa_K215107). Its expression is IPTG inducible. false false _320_ 0 2811 9 It's complicated true n/a false Jeff Nivala component2052459 1 BBa_R0011 component2052465 1 BBa_B0034 component2052466 1 BBa_K215012 annotation2052466 1 BBa_K215012 range2052466 1 82 1662 annotation2052465 1 BBa_B0034 range2052465 1 64 75 annotation2052459 1 BBa_R0011 range2052459 1 1 54 BBa_K215012 1 BBa_K215012 Secretion Signal and Streptavidin Binding Tags on GFP 2009-10-17T11:00:00Z 2015-05-08T01:11:30Z E0040 (GFP) was amplified using NheI K215002 drives the expression of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K215001 BBa_K215001] by placing it under the control of a strong, IPTG-inducible promoter (R0011) and RBS (R0034). Any favorite protein (afp) can be inserted into a composite tag [http://partsregistry.org/wiki/index.php?title=Part:BBa_K215001 BBa_K215001]. The composite tag has an NheI site (compatible with XbaI and SpeI, but make sure the resulting product stays in frame, described below) which places the afp in between a series of tags which can be used with the [http://2009.igem.org/Team:Washington University of Washington 2009 Ideal Protein Purification system (IPP)]. The series of tags are, respectively: a Nano-Tag (binds to streptavidin), a 6x His tag (for IMAC purification), a TEV cute site (for removal of N-terminal tags), the NheI site (insertion of afp), TEV, 6x His tag, and the 181 C-terminal amino acids of prtB (secretion tag recognized by the secretion system: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K215107 BBa_K215107]). In order for the secretion tag to signal the secretion of afp the BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K215107 BBa_K215107] must be present as well. Cutting a BioBrick coding sequence at X and S and pasting into the NheI site of this construct would result in a stop codon at the resulting scar site. Therefore, to insert a gene into the K215001 of this construct, a PCR product must be generated that keeps the gene of interest in frame with the rest of the sequence. To do this: false false _320_ 0 5005 9 Not in stock false sdsdsd false Jeff Nivala annotation2052469 1 K215012 range2052469 1 833 1581 annotation2052467 1 K215012 range2052467 1 1 115 annotation2052468 1 E0040 range2052468 1 116 832 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K215010_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggacgttgaagcatggctgggtgcccgtgtaccgctggttgaaacgggcagcgcacatcaccaccatcatcatggttccgccgaaaacctctactttcagggcggctctgctgctagacgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaactagcggttctgccgagaatctgtacttccaaggtggctccgctcatcaccaccatcatcacggtagcgcaggcggcactgacacctttgacttctctggttactctaacaatcagcgtatcaacctgaacgagggttctttctctgacgttggtggtctgaagggcaacgtttctatcgcgcatggtgttaccatcgaaaacgcgatcggtggttctggtaacgacatcctgatcggtaatggcgcggataacatcctccagggtggtgcgggtgacgacgttctgtacggttctacgggtgcggacacgctgacgggtggcgctggtcgtgacattttcgtatatggtagcggtcaagactctaccgtttctgcatacgactggatcacggattttcagacgggtatcgacaaaatcgacctgtccgctttccgtaatgaaggtcagctgtcttttgttcaggaccagtttactggtaaaggccaggaggttatgctgcaatgggacgcggcgaactctacgaccaatctgtggctgcacgaagcgggtcactcttctgttgactttctcgttcgtatcgttggccagaccgcgcagagcgacattatcgtctaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K215012_sequence 1 atggacgttgaagcatggctgggtgcccgtgtaccgctggttgaaacgggcagcgcacatcaccaccatcatcatggttccgccgaaaacctctactttcagggcggctctgctgctagacgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaactagcggttctgccgagaatctgtacttccaaggtggctccgctcatcaccaccatcatcacggtagcgcaggcggcactgacacctttgacttctctggttactctaacaatcagcgtatcaacctgaacgagggttctttctctgacgttggtggtctgaagggcaacgtttctatcgcgcatggtgttaccatcgaaaacgcgatcggtggttctggtaacgacatcctgatcggtaatggcgcggataacatcctccagggtggtgcgggtgacgacgttctgtacggttctacgggtgcggacacgctgacgggtggcgctggtcgtgacattttcgtatatggtagcggtcaagactctaccgtttctgcatacgactggatcacggattttcagacgggtatcgacaaaatcgacctgtccgctttccgtaatgaaggtcagctgtcttttgttcaggaccagtttactggtaaaggccaggaggttatgctgcaatgggacgcggcgaactctacgaccaatctgtggctgcacgaagcgggtcactcttctgttgactttctcgttcgtatcgttggccagaccgcgcagagcgacattatcgtctaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z