BBa_K2150106 1 BBa_K2150106 6249 antitoxin CDS 2016-10-11T11:00:00Z 2016-10-18T06:31:46Z a a false false _2620_ 29734 29734 9 false a false Zepeng Mu annotation2519782 1 double stop codon range2519782 1 213 218 annotation2519781 1 antitoxin ParD2 CDS range2519781 1 1 212 BBa_K2150106_sequence 1 tggtggtcaaccgggcattgctggcgagcgtcgacgcactgtcgcgtgatgagcagattgagctcgtcgagcacatcaacggaaacctagccgagggcatgcatatcagcgaggccaaccaggcgctcatcgaagcgcgggccaatgacaccgacgatgctcattggtccaccattgatgacttcgacaagcggatccgcgcccggctcggataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z