BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K2150122 1 BBa_K2150122 5980 2016-10-13T11:00:00Z 2016-10-18T06:38:08Z a a false false _2620_ 29734 29734 9 false a false Zepeng Mu annotation2519786 1 5980 toxin CDS range2519786 1 1 366 BBa_K1679038 1 BBa_K1679038 RiboJ 2015-09-17T11:00:00Z 2015-09-18T01:15:04Z Synthesized by Genewiz. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin immediately downstream to help expose the RBS. STRSV can cleaves the mRNA autocatalytically at a defined residue, which had the effect of cleaving extraneous RNA leaders that arose from transcription from promoters with different start sites.[1] Attributed to the biochemical function mentioned above, RiboJ has insulating capability. We use it to buffer synthetic circuits from genetic context. [1] Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142. false false _2097_ 25072 25072 9 false After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin. Users can insert it into promoter and RBS to reduce noise caused by upstream sequence and stabilize mRNA. false Xihan Zhang BBa_K2150125 1 BBa_K2150125 Ptet + RBS + RiboJ + toxin 5980 CDS 2016-10-18T11:00:00Z 2016-10-19T11:25:14Z a a false false _2620_ 29734 29734 9 false a false Zepeng Mu component2524558 1 BBa_B0033 component2524551 1 BBa_R0040 component2524550 1 BBa_C0040 component2524561 1 BBa_K2150122 component2524556 1 BBa_K1679038 annotation2524551 1 BBa_R0040 range2524551 1 694 747 annotation2524556 1 BBa_K1679038 range2524556 1 756 830 annotation2524558 1 BBa_B0033 range2524558 1 839 849 annotation2524561 1 BBa_K2150122 range2524561 1 856 1221 annotation2524550 1 BBa_C0040 range2524550 1 1 685 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23330 1 SsrA range23330 1 621 654 BBa_B0033_sequence 1 tcacacaggac BBa_K2150125_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagttaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagcttactagagtcacacaggactactagatgaccttacagttaattagtgcagaagaaattattcagtttcatgatcgcttactgcgtgtgacgcctggcgttaccggtatgcccgacccggaacgtgccgaagcactgatgtatcgcgtgctgaatcagattgaatatgaaggtgtgaccgatgtgtggctgttagcagccatgcatctgttaaccattagtcgcggctatatttttaatgatggcaacaagcgtaccgccctgtttattaccctgctgtttctgaaacgtaatggtatttctctggcagccaatccggattttgtggatatgaccgttgatgccgccgcaggccgcttaaccttagaacagattgcagttcgtctgcgcgca BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K2150122_sequence 1 atgaccttacagttaattagtgcagaagaaattattcagtttcatgatcgcttactgcgtgtgacgcctggcgttaccggtatgcccgacccggaacgtgccgaagcactgatgtatcgcgtgctgaatcagattgaatatgaaggtgtgaccgatgtgtggctgttagcagccatgcatctgttaaccattagtcgcggctatatttttaatgatggcaacaagcgtaccgccctgtttattaccctgctgtttctgaaacgtaatggtatttctctggcagccaatccggattttgtggatatgaccgttgatgccgccgcaggccgcttaaccttagaacagattgcagttcgtctgcgcgca BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K1679038_sequence 1 ttaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z