BBa_K2152000 1 BBa_K2152000 human Epidermal Growth Factor(hEGF) with His-tag 2016-10-12T11:00:00Z 2016-10-13T07:05:13Z It is synthesized by GenScript, the sequence comes from human genome. Human EGF（epidermal growth factor）is a 6045-Da protein with 53 amino acid residues. It can stimulate cell growth, proliferation and differentiation by binding to its receptor EGFR both in vivo and vitro. There is a phoA signal peptide at the N-terminus, which is a fragment of signal peptide that guides the protein to go across cytomembrane and do not decrease activity of the protein. His-tag is an amino acid motif in proteins that consists of at least six histidine (His) residues, at the N-terminus of the EGF protein. It is also known as hexa histidine-tag. This part is in charge of IBD treatment. false false _2622_ 32586 32586 9 false There is a phoA signal peptide at the N-terminus, which is a fragment of signal peptide that guides the protein to go across cytomembrane and do not decrease activity of the protein. His-tag is an amino acid motif in proteins that consists of at least six histidine (His) residues, at the N-terminus of the EGF protein. It is also known as hexa histidine-tag. This tag is used for protein purification. false Tianhao Li annotation2497402 1 phoA range2497402 1 1 63 annotation2497434 1 His-tag range2497434 1 223 240 annotation2497410 1 hEGF range2497410 1 64 222 BBa_K2152000_sequence 1 atgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagccaattccgacagcgagtgtccgttgagtcacgacggctactgtctgcacgatggcgtttgcatgtatattgaagctctggacaaatacgcttgtaactgtgttgttggctacatcggtgaacgctgccagtacagagatctgaaatggtgggaactgcgtcatcatcatcatcatcactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z