BBa_K2152001 1 BBa_K2152001 human Epidermal Growth Factor（hEGF） with FLAG-tag 2016-10-12T11:00:00Z 2016-10-13T07:05:13Z hEGF sequence comes from human genome and is synthesized by GenScript. Human EGF（epidermal growth factor）is a 6045-Da protein with 53 amino acid residues. There is a phoA signal peptide at the N-terminus and a FLAG tag at the C-terminus of hEGF protein. PhoA is a fragment of signal peptide that guides the protein to go across cytomembrane and do not decrease activity of the protein. FLAG-tag is a polypeptide protein tag that can be added to a protein using recombinant DNA technology, having the sequence motif DYKDDDDK. It can stimulate cell growth, proliferation and differentiation by binding to its receptor EGFR both in vivo and vitro. This part is in charge of IBD treatment in our project. false false _2622_ 32563 32563 9 false There is a phoA signal peptide at the N-terminus and a FLAG tag at the C-terminus of hEGF protein. PhoA is a signal peptide that can guide protein to secrete to periplasmic space in E.coli. We can detect the FLAG tag on the protein by western blotting. false Dekang Li annotation2497403 1 phoA range2497403 1 1 63 annotation2497411 1 hEGF range2497411 1 64 222 annotation2497433 1 FLAG range2497433 1 223 246 BBa_K2152001_sequence 1 atgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagccaattccgacagcgagtgtccgttgagtcacgacggctactgtctgcacgatggcgtttgcatgtatattgaagctctggacaaatacgcttgtaactgtgttgttggctacatcggtgaacgctgccagtacagagatctgaaatggtgggaactgcgtgattacaaggatgacgacgataagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z