BBa_K2152002 1 BBa_K2152002 CsgA-EGF 2016-10-12T11:00:00Z 2016-10-13T10:01:58Z For CsgA, it is from a gift from Allen Y. Chen, Biophysics Program, Harvard University. For EGF, it is synthesized by GenScript. Through molecular programming of the bacterial extracellular matrix material by genetically appending EGF peptide to the amyloid protein CsgA, the dominant proteinaceous component in E. coli biofilms. These engineered CsgA fusion proteins are successfully secreted and extracellularly self-assemble into amyloid nanofibrer networks that retain the functions of the displayed peptide domains. It may be able to use the function of EGF to treat IBD. false false _2622_ 32588 32588 9 false We use overlap PCR to connect CsgA and EGF with a linker. And to make a standard part, we performed site-directed mutagenesis to eliminate the restriction site of PstⅠ. false Shenjian Ai annotation2497373 1 linker range2497373 1 442 480 annotation2497375 1 EGF range2497375 1 481 639 annotation2497437 1 his tag range2497437 1 640 657 annotation2497372 1 CsgA range2497372 1 1 441 BBa_K2152002_sequence 1 atgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgccgccgttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagggtggcggtggctctggtggcggtggctctaattccgacagcgagtgtccgttgagtcacgacggctactgtctgcacgatggcgtttgcatgtatattgaagctctggacaaatacgcttgtaactgtgttgttggctacatcggtgaacgctgccagtacagagatctgaaatggtgggaactgcgtcaccaccaccaccaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z