BBa_K2152003 1 BBa_K2152003 Bacteriophage Phi X 174 lysis gene E(wild type) 2016-10-12T11:00:00Z 2016-10-13T07:58:23Z Bacteriophage Phi X 174 lysis gene E Lysis protein E spanning the inner and outer membrane of the bacterial, leading to low local degradations of peptidoglycan, allow the release of cytoplasmic content. false false _2622_ 32566 32566 9 false / false XULIN GE BBa_K2152003_sequence 1 atggtacgctggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaacattattaatggcgtcgagcgtccggttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcaggaaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtgcggaaggagtgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z