BBa_K2152004 1 BBa_K2152004 Bacteriophage Phi X 174 lysis gene E with T7 and RBS 2016-10-12T11:00:00Z 2016-10-13T08:13:45Z Bacteriophage Phi X 174 Lysis protein E spanning the inner and outer membrane of the bacterial, leading to low local degradations of peptidoglycan, allow the release of cytoplasmic content. Use IPTG to induce the transcription of T7 promoter,and the expression of gene E protein in E.coli BL21. false false _2622_ 32566 32566 9 false Introduce a Point mutation at a XbaI restriction site. false XULIN GE annotation2497965 1 Ribosome Binding Site range2497965 1 69 74 annotation2497975 1 Bacteriophage Phi X 174 lysis gene E range2497975 1 82 360 annotation2497964 1 T7 promoter range2497964 1 1 17 BBa_K2152004_sequence 1 taatacgactcactataggggaattgtgagcggataacaattccccaataattttgtttaactttaagaaggagatataccatggtacgctggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaacattattaatggcgtcgagcgtccggttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcaggaaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtgcggaaggagtgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z