BBa_K215210 1 BBa_K215210 IPTG Inducible 1tmr OmpA Surface Display of WT Streptavidin 2009-09-30T11:00:00Z 2015-05-08T01:11:30Z BBa_J36841 in BBa_K215200 This part should display WT streptavidin + 6His, BBa_J36841, on the surface of the cell via the OmpA display system when induced with IPTG. Note: there's no T after this sequence and before the SpeI site. false false _320_ 0 5567 9 It's complicated false See BBa_K215200 for the procedure used to put WT streptavidin in the OmpA display construct. false Alex Leone component2027688 1 BBa_R0011 component2027694 1 BBa_B0034 component2027700 1 BBa_K215260 annotation2027688 1 BBa_R0011 range2027688 1 1 54 annotation2027700 1 BBa_K215260 range2027700 1 82 702 annotation2027694 1 BBa_B0034 range2027694 1 64 75 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K215260 1 BBa_K215260 Lpp + 1tmr OmpA + GS Linker + TEV site + WT Streptavidin + 6His 2009-09-30T11:00:00Z 2015-05-08T01:11:30Z BBa_K215200 + BBa_J36841 This is a fusion protein that combines Lpp, OmpA, and WT streptavidin. See BBa_K215210 for the full induceable WT streptavidin dispaly system. false false _320_ 0 5567 9 Not in stock false See BBa_K215200 for the method used to put WT streptavidin in the OmpA surface display construct. false Alex Leone annotation2027685 1 GS Linker - GGGSGGGSGGG range2027685 1 157 189 annotation2027684 1 BBa_J36836 - 1tmr OmpA range2027684 1 94 156 annotation2027687 1 BBa_J36841 - WT Streptavidin w/o start codon range2027687 1 217 621 annotation2027686 1 TEV Site - ENLYFQG range2027686 1 190 210 annotation2027683 1 BBa_J36835 - Lpp Signaling Peptide range2027683 1 1 87 BBa_B0034_sequence 1 aaagaggagaaa BBa_K215260_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagactagaaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcggtggtggttctggtggtggttctggtggtggtgaaaacctgtattttcagggtgctagagctgaagctggtatcaccggcacctggtacaaccagctgggatccaccttcatcgttaccgctggtgctgacggtgctctgaccggtacctacgaatccgctgttggtaacgctgaaagccgctacgttctgaccggtcgttacgactccgctccggctaccgacggttccggaaccgctctgggttggaccgttgcttggaaaaacaactaccgtaacgctcactccgctaccacctggtctggccagtacgttggtggtgctgaagctcgtatcaacacccagtggttgttgacctccggcaccaccgaagccaacgcgtggaaatccaccctggttggtcacgacaccttcaccaaagttaaaccgtccgctgcttcccatcaccatcaccaccattaataa BBa_K215210_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagactagaaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcggtggtggttctggtggtggttctggtggtggtgaaaacctgtattttcagggtgctagagctgaagctggtatcaccggcacctggtacaaccagctgggatccaccttcatcgttaccgctggtgctgacggtgctctgaccggtacctacgaatccgctgttggtaacgctgaaagccgctacgttctgaccggtcgttacgactccgctccggctaccgacggttccggaaccgctctgggttggaccgttgcttggaaaaacaactaccgtaacgctcactccgctaccacctggtctggccagtacgttggtggtgctgaagctcgtatcaacacccagtggttgttgacctccggcaccaccgaagccaacgcgtggaaatccaccctggttggtcacgacaccttcaccaaagttaaaccgtccgctgcttcccatcaccatcaccaccattaataa BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z