BBa_K215250 1 BBa_K215250 Lpp + 1tmr OmpA + GS Linker + TEV site + NheI Site 2009-09-29T11:00:00Z 2015-05-08T01:11:30Z Harvard iGEM 2006: BBa_J36836. We added a GS Linker and TEV site. This is a fusion protein that displays your favorite gene inserted into the NheI site. false false _320_ 0 5567 9 Not in stock false Anything inserted into the NheI shouldn't have a start codon and gene should still be in frame. false Alex Leone annotation2027530 1 BBa_J36835 - Lpp Signaling Peptide range2027530 1 1 87 annotation2027537 1 TEV Site - ENLYFQG range2027537 1 190 210 annotation2027535 1 GS Linker - GGGSGGGSGGG range2027535 1 157 189 annotation2027552 1 NheI range2027552 1 211 216 annotation2027533 1 BBa_J36836 - 1tmr OmpA range2027533 1 94 156 BBa_K215250_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagactagaaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcggtggtggttctggtggtggttctggtggtggtgaaaacctgtattttcagggtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z