BBa_K216003 1 BBa_K216003 TNT receptor TNT-R3 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z Derived by mutagenesis of the Escherichia coli periplasmic ribose-binding protein: see Looger, L., Dwyer, M.A., Smit, J.J., and Wellinga, H.W. 2003. Computational design of receptor proteins with novel functions. Nature 423, 185-190. TNT-R3: a computationally designed receptor binding TNT, made by mutation of the Escherichia coli periplasmic ribose-binding protein: see Looger, L., Dwyer, M.A., Smit, J.J., and Wellinga, H.W. 2003. Computational design of receptor proteins with novel functions. Nature 423, 185-190. This receptor interacts with a hybrid transmembrane protein Trz, created by combining the normal partner of ribose-binding-protein, Trg, with the intracellular part of 2-component sensor protein EnvZ, which normally phosphorylates response regulator protein OmpR, allowing it to activate promoters such as PompC (see Baumgartner, J.W., Kim, C., Brisette, R.E., Inouye, M., Park, C., and Hazelbauer, G.L. 1994. Transmembrane signalling by a hybrid protein: communication from the domain of chemoreceptor Trg thate recognizes sugar-binding proteins to the kinase/phosphatase domainof Osmosensor EnvZ. J. Bacteriol. 176, 1157-1163). To use this receptor, include it in a system with Trz and a reporter gene controlled by PompC.To avoid cross-talk, it may be necessary to use a chassis lacking EnvZ and ribose-binding protein. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027064 1 RBS range2027064 1 1 7 annotation2027065 1 START range2027065 1 12 14 annotation2027066 1 STOP range2027066 1 846 851 BBa_K216003_sequence 1 aaggagatatcatgaaagataccattgcattggtagtatccacacttaatagcccattcctggtatccctgaaagatggcgctcagaaagaagccgacaaactgggctataacctggtcgtcctggactcccagaacaacccggccaaagaactggccaacgtgcaggatctgaccgtgcgcggcaccaaaatcctgctgattaacccgaccgatagcgatgccgttggtaacgccgttaaaatggccaaccaggcgaacattccggtgattaccctgagcagccaggccaccaaaggcgaagtcgtgtcccatattgccagcgataacgtactgggtggcaaaattgcgggcgattatattgccaaaaaagccggcgagggcgccaaagttatcgaactgcaaggcattgctggcacctctagcgcacgcgaaagcggtgaaggctttcagcaggccgtagccgcacacaaatttaacgttctggcgagccagccggcagatatcgatcgcatcaaaggcctgaacgtgatgcagaatctgctgaccgcacatccggatgtgcaggcggtatttgcgcagttcgatgaaatggcactgggcgcactgcgtgcgctgcaaaccgccggcaaaagcgatgtgatggttgtgggcttcagcggtaccccggatggcgaaaaagccgttaacgatggcaaactggcggcaaccattgcaagcctgccggatcagattggcgcaaaaggcgtggaaaccgcggataaagtactgaaaggcgaaaaagttcaggcgaaatatccagtagactgcaagcttgtcgtaaaacagaacgggggctcccactggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z