BBa_K216009 1 BBa_K216009 PyeaR with lacZ 2009-10-15T11:00:00Z 2015-05-08T01:11:30Z Made by combining promoter Pyear BBa_K216005 with lacZ' reporter BBa_J33202. This is the nitrate- and nitrite-responsive promter PyeaR linked to a lacZ' reporter, for promoter characterization by Miller Assay. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 component2047021 1 BBa_K216005 component2047024 1 BBa_J33202 annotation2047021 1 BBa_K216005 range2047021 1 1 100 annotation2047024 1 BBa_J33202 range2047024 1 109 351 BBa_J33202 1 BBa_J33202 lacZ 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR from E. coli BL21, which possesses an intact lacZ gene. Primers were designed based on sequence from GenBank accession J01636, GI:146575. A stop codon was artificially introduced to replace codon 78. The sequence reported here is derived by sequencing of the Biobrick construct. Released HQ 2013 This gene encodes the N-terminal 77 amino acid residues of LacZ. When expressed in an E. coli host carrying the lacZ-delta-M15 mutation, common in laboratory strains, it complements the delection resulting in the production of active LacZ, which can be detected by various means, including chromogenic substrates such as Xgal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) and ONPG (o-nitrophenyl galactoside). false false _63_ 0 837 63 In stock true Note that a stop codon was introduced to replace codon 78 of lacZ, resulting in production only of the N-terminal 77 amino acid residues of LacZ. This is sufficient to complement the lacZ-delta-M15 mutation commonly found in laboratory strains of E. col used for alpha-complementation. false Chris French annotation1902819 1 lacZ' range1902819 1 13 243 annotation1902818 1 rbs range1902818 1 1 4 BBa_K216005 1 BBa_K216005 PyeaR promoter, responsive to nitrate, nitrite and nitric oxide 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z BioBricked from E. coli K-12 genomic DNA by the Edinburgh 2009 iGEM team. PyeaR promoter. This is the promoter of the Escherichia coli yeaR/yoaG operon (see Lin, H.-Y., Bledsoe, P.J., and Stewart, V. 2007. Activation of yeaR-yoaG operon transcription by the nitrate-responsive regulator NarL is independent of oxygen-responsive regulator Fnr in ''Escherichia coli'' K-12. J. Bacteriol. 189, 7539-7548). Unlike other E. coli promoters responding to nitrate and nitrite, this promoter is not repressed under aerobic conditions. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027075 1 promoter -10 region range2027075 1 89 94 annotation2027072 1 NarL-binding region range2027072 1 50 65 annotation2027073 1 NsrR-binding region range2027073 1 58 80 annotation2027074 1 promoter -35 region range2027074 1 66 71 BBa_J33202_sequence 1 gaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K216009_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacgtactagaggaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K216005_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z