BBa_K216005 1 BBa_K216005 PyeaR promoter, responsive to nitrate, nitrite and nitric oxide 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z BioBricked from E. coli K-12 genomic DNA by the Edinburgh 2009 iGEM team. PyeaR promoter. This is the promoter of the Escherichia coli yeaR/yoaG operon (see Lin, H.-Y., Bledsoe, P.J., and Stewart, V. 2007. Activation of yeaR-yoaG operon transcription by the nitrate-responsive regulator NarL is independent of oxygen-responsive regulator Fnr in ''Escherichia coli'' K-12. J. Bacteriol. 189, 7539-7548). Unlike other E. coli promoters responding to nitrate and nitrite, this promoter is not repressed under aerobic conditions. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027072 1 NarL-binding region range2027072 1 50 65 annotation2027073 1 NsrR-binding region range2027073 1 58 80 annotation2027075 1 promoter -10 region range2027075 1 89 94 annotation2027074 1 promoter -35 region range2027074 1 66 71 BBa_J52008 1 BBa_J52008 luciferase: luciferin 2-monooxygenase from Renilla reniformis (EC 1.13.12.5; SwissProt:: P27652) 2006-10-13T11:00:00Z 2015-08-31T03:54:04Z - Released HQ 2013 Rluc is a protein called Renilla`s luciferase and it emits light when adding the right substrate. That is why it can bi used as a reported to track other proteins or to monitor the activity of a promotor. false true _80_ 0 800 80 In stock true Rluc is cloned in BioBrick vector pSB1AK3. true Monika Ciglic annotation1902845 1 Rluc range1902845 1 1 936 annotation1902833 1 Rluc range1902833 1 1 936 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938046 1 rbs range1938046 1 4 10 annotation1938045 1 SacI range1938045 1 1 3 BBa_K216014 1 BBa_K216014 PyeaR with Renilla luciferase 2009-10-15T11:00:00Z 2015-05-08T01:11:30Z Made by joining PyeaR BioBrick BBa_K216005 to a PCR fusion of strong synthetic ribosome binding site J15001 and Renilla luciferase BioBrick J52008. This is nitrate- and nitrite-responsive promoter PyeaR of ''Escherichia coli'' joined to ''Renilla'' luciferase with the addition of a strong bacterial ribosome binding site. This should lead to production of light in the presence of nitrate/nitrate and coelenterazine. false false _317_ 0 837 163 It's complicated true No special considerations. Sequencing suggests that there is an extra 'A' base following the scar between the RBS and the Renilla luciferase; that is, the scar region reads TACTAGAATG instead of TACTAGATG. If the sequencing is correct, this base must be present in J52008 or have been introduced by a random event during the construction process. This makes the gap between the RBS and start codon one base longer, but still well within the optimal range for E. coli and B. subtilis. false Edinburgh iGEM 2009 component2047073 1 BBa_K216005 component2047079 1 BBa_J52008 component2047076 1 BBa_J15001 annotation2047076 1 BBa_J15001 range2047076 1 109 118 annotation2047079 1 BBa_J52008 range2047079 1 125 1060 annotation2047073 1 BBa_K216005 range2047073 1 1 100 BBa_J52008_sequence 1 atggcttccaaggtgtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa BBa_K216014_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacgtactagagctcaaggaggtactagatggcttccaaggtgtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa BBa_J15001_sequence 1 ctcaaggagg BBa_K216005_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z