BBa_K2165004 1 BBa_K2165004 CUP1 yeast inducible promoter with RFC[10] restriction sites removed 2016-10-13T11:00:00Z 2016-10-14T09:20:00Z The CUP1 promoter was identified in the 5' untranslated region of the metallothionein gene in Saccharomyces cerevisiae. CUP1 is a commonly used inducible transcription promoter for yeast that leads to enhanced expression of its respective gene(s) in the presence of cupric ions. The documented natural variants of the CUP1 promoter, including part K945002 in the registry (http://parts.igem.org/Part:BBa_K945002), contain RFC[10] illegal restriction sites that have been eliminated in this part so that it may be used in other biobricks. false false _2636_ 28370 28370 9 false The Yeast Promoter Atlas was used to prevent altering bases that served a significant regulatory purpose (http://ypa.csbb.ntu.edu.tw/do?act=gene_by_kw&query=YHR053C#promoter_map). One base pair was substituted to eliminate the XbaI site in the middle of the sequence. false Roya Amini-Naieni annotation2531616 1 ChangedBase(GtoA) range2531616 1 84 84 annotation2530978 1 pCup1 range2530978 1 1 263 BBa_K2165004_sequence 1 aaaactagccttgttgctagttagaaaaagacatttttgctgtcagtcactgtcaagagattcttttgctggcatttcttctaaaagcaaaaagagcgatgcgtcttttccgctgaaccgttccagcaaaaaagactaccaacgcaatatggattgtcagaatcatataaaagagaagcaaataactccttgtcttgtatcaattgcattataatatcttcttgttagtgcaatatcatatagaagtcatcgaaatagatatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z