BBa_K2169138 1 BBa_K2169138 ZnS nucleation Tag 2016-10-13T11:00:00Z 2016-10-14T12:49:17Z Chen, A.Y. et al., 2014. Synthesis and patterning of tunable multiscale materials with engineered cells. Nature materials, 13(5), pp.515???23. Available at: http://dx.doi.org/10.1038/nmat3912. Tag used to nucleate metal sulfides. false false _2640_ 25347 25347 9 false Short sequence, so we did not order it as a separate part. It is likely best to add it either via PCR or order the tagged protein as synthetic DNA, as we did. false Filip Cierniak annotation2508824 1 ZnS Nucleation Tag range2508824 1 1 27 BBa_K2169138_sequence 1 tgcaacaacccgatgcaccagaactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z